National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5323R-1 
 Symbol CG5323  Full Name CG5323 
 CG No CG5323  Old CG No CG5323 
 Synonyms CG5323 
 Accession No (Link to NCBI) NM_137502.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGATCCAGCAACAGCGCCAG 
 Primer Seq. 3'
aatctagaggtaccGACTTGGGGAATGCTCTCGGG 
 Predicted Fragment Size
438 
 IR fragment full Seq
0001 ATGATCCAGC AACAGCGCCA GAAAATCGAG GCCGCGGTAA CGGAGATGAT CGACGACATG 
0061 GACAAGGACG CACCTGCGCA AAATGCAGAA TGAGATGCAC TTGTGTGCGG CCAAGTGCTG 
0121 CCAGGATGGA ACCTCCAGCG TGGACAGTGT CCAGAGATGT GTGGATCGAT GCTCCGCGCC 
0181 CATGACGAGG GCACAGAACT ACGTTCAACA CGAATTGGGC GAGTTCCAGG GCAGACTTCA 
0241 ACGTTGCGTC ATGCAATGCA ACGACGATGT GAAGGTGAAA ATGCCGCCCA GTCCCAATGA 
0301 GGATCAGATA GCCAAGTACA CCGACCAATT CGAGCGCTGT GCCATCCAGT GTGTGGACAA 
0361 GCATGTGGGC CTCATTCCCG GCATGATGAA GACCATGAAG GCTGTGCTCT CCAAGGGACC 
0421 CGAGAGCATT CCCCAAGTC 
 in silico PCR Fragment
0001 ATGATCCAGC AACAGCGCCA GAAAATCGAG GCCGCGGTAA CGGAGATGAT CGACGACATG 
0061 GACAA-GACG CACCTGCGCA AAATGCAGAA TGAGATGCAC TTGTGTGCGG CCAAGTGCTG 
0121 CCAGGATGGA ACCTCCAGCG TGGACAGTGT CCAGAGATGT GTGGATCGAT GCTCCGCGCC 
0181 CATGACGAGG GCACAGAACT ACGTTCAACA CGAATTGGGC GAGTTCCAGG GCAGACTTCA 
0241 ACGTTGCGTC ATGCAATGCA ACGACGATGT GAAGGTGAAA ATGCCGCCCA GTCCCAATGA 
0301 GGATCAGATA GCCAAGTACA CCGACCAATT CGAGCGCTGT GCCATCCAGT GTGTGGACAA 
0361 GCATGTGGGC CTCATTCCCG GCATGATGAA GACCATGAAG GCTGTGCTCT CCAAGGGACC 
0421 CGAGAGCATT CCCCAAGTC 
 Assemble Data

5323R-1.IR_full       1   ATGATCCAGCAACAGCGCCAGAAAATCGAGGCCGCGGTAACGGAGATGATCGACGACATG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5323R-1.in silico     1   ATGATCCAGCAACAGCGCCAGAAAATCGAGGCCGCGGTAACGGAGATGATCGACGACATG 60


5323R-1.IR_full       61  GACAAGGACGCACCTGCGCAAAATGCAGAATGAGATGCACTTGTGTGCGGCCAAGTGCTG 120
                          ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
5323R-1.in silico     61  GACAA-GACGCACCTGCGCAAAATGCAGAATGAGATGCACTTGTGTGCGGCCAAGTGCTG 120


5323R-1.IR_full       121 CCAGGATGGAACCTCCAGCGTGGACAGTGTCCAGAGATGTGTGGATCGATGCTCCGCGCC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5323R-1.in silico     121 CCAGGATGGAACCTCCAGCGTGGACAGTGTCCAGAGATGTGTGGATCGATGCTCCGCGCC 180


5323R-1.IR_full       181 CATGACGAGGGCACAGAACTACGTTCAACACGAATTGGGCGAGTTCCAGGGCAGACTTCA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5323R-1.in silico     181 CATGACGAGGGCACAGAACTACGTTCAACACGAATTGGGCGAGTTCCAGGGCAGACTTCA 240


5323R-1.IR_full       241 ACGTTGCGTCATGCAATGCAACGACGATGTGAAGGTGAAAATGCCGCCCAGTCCCAATGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5323R-1.in silico     241 ACGTTGCGTCATGCAATGCAACGACGATGTGAAGGTGAAAATGCCGCCCAGTCCCAATGA 300


5323R-1.IR_full       301 GGATCAGATAGCCAAGTACACCGACCAATTCGAGCGCTGTGCCATCCAGTGTGTGGACAA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5323R-1.in silico     301 GGATCAGATAGCCAAGTACACCGACCAATTCGAGCGCTGTGCCATCCAGTGTGTGGACAA 360


5323R-1.IR_full       361 GCATGTGGGCCTCATTCCCGGCATGATGAAGACCATGAAGGCTGTGCTCTCCAAGGGACC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5323R-1.in silico     361 GCATGTGGGCCTCATTCCCGGCATGATGAAGACCATGAAGGCTGTGCTCTCCAAGGGACC 420


5323R-1.IR_full       421 CGAGAGCATTCCCCAAGTC 439
                          |||||||||||||||||||
5323R-1.in silico     421 CGAGAGCATTCCCCAAGTC 439

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   420  NM_137502.3  CG5323-RA (CG5323), mRNA 
0.47   NM_143283.1  CG5882-RA (CG5882), mRNA 
0   NM_137701.2  CG4030-RA (CG4030), mRNA 
0   NM_170360.1  CG4976-RA (Mes-4), mRNA 
0   NM_206662.1  CG12065-RC, transcript variant C (CG12065), mRNA 
0   NM_132265.2  CG12065-RA, transcript variant A (CG12065), mRNA 
0   NM_137865.1  CG13518-RA (Obp58b), mRNA 
0   NM_141805.1  CG5207-RA (scpr-A), mRNA 
0   NM_078878.2  CG10123-RA (Top3alpha), mRNA 
0   NM_136131.2  CG10189-RA (CG10189), mRNA 
0   NM_142486.2  CG7708-RA, transcript variant A (CG7708), mRNA 
0   NM_169832.1  CG7708-RB, transcript variant B (CG7708), mRNA 
0   NM_134820.2  CG10882-RA (CG10882), mRNA 
0   NM_001043138.1  CG17672-RA (CG17672), mRNA 
0   NM_134708.2  CG13949-RA (CG13949), mRNA 
0   10  NM_176591.1  CG15532-RC, transcript variant C (hdc), mRNA 
0   10  NM_079853.2  CG15532-RA, transcript variant A (hdc), mRNA 
0   NM_170478.1  CG15532-RB, transcript variant B (hdc), mRNA 
0   NM_169964.1  CG31343-RA (CG31343), mRNA 
0   NM_135169.2  CG9493-RA (Pez), mRNA 
0   NM_080531.2  CG5481-RA (lea), mRNA 
0   NM_169489.1  CG7518-RA, transcript variant A (CG7518), mRNA 
0   NM_141993.2  CG7518-RB, transcript variant B (CG7518), mRNA 
0   NM_143138.1  CG5127-RA (CG5127), mRNA 
0   NM_080765.2  CG13777-RC, transcript variant C (milt), mRNA 
0   NM_164736.1  CG13777-RA, transcript variant A (milt), mRNA 
0   NM_164674.1  CG31643-RA (CG31643), mRNA 
0   NM_141895.2  CG14740-RA (CG14740), mRNA 
0   NM_137817.2  CG3413-RB, transcript variant B (wdp), mRNA 
0   NM_166526.1  CG3413-RD, transcript variant D (wdp), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.