National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5270R-3 
 Symbol CG5270  Full Name CG5270 
 CG No CG5270  Old CG No CG5270 
 Synonyms CG5270 
 Accession No (Link to NCBI) NM_169389.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAGCAGGAGGAGAATATGCAG 
 Primer Seq. 3'
aatctagaggtaccGCCAGCCACAGGACCAAAAGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CAGCAGGAGG AGAATATGCA GCAGCTGCTA AACTTGTTGC CCAAGGATCA GCGGCAGATC 
0061 TTTGAGATCT TTATCCAGTG GCTCAATGGC AAGTCCTCCG GGCCCATTCA ATTGCACCAG 
0121 AACGCCCTGC TAACCGTGCT TNCAGGCGTC GCCCTATCCC GCCCTGCAAC TGCTACAGTT 
0181 GCTCCACGAA CGGTCCAAAC TGCACATTGG ACAAATAATT TCCACCTTGC TTCGACAGCT 
0241 GCTANGATGG CGATGTCGCA TCGCCGCGNT TCCCTTTGTG TGCTGGCCAA TTTTCCGGCA 
0301 AGCGTTTTGG AGGCCTCTAC ACTTCGTCAG AAATTGATGA CTCGTCTAGT GGTTGATTCC 
0361 ATAACCAGTG AACACTTAAT GCTGACCATG TTGGCGCGCA GCGATGGACA ACTCCTGGAT 
0421 GATCTGTTGC ATGAGCAGCA ACTGACCATG CGGGCGCAGT GTAGTGAGGC GGCGCCCACT 
0481 AAACTTTTGG TCCTGTGGCT GGC 
 in silico PCR Fragment
0001 CAGCAGGAGG AGAATATGCA GCAGCTGCTA AACTTGTTGC CCAAGGATCA GCGGCAGATC 
0061 TTTGAGATCT TTATCCAGTG GCTCAATGGC AAGTCCTCCG GGCCCATTCA ATTGCACCAG 
0121 AACGCCCTGC TAACCGTGCT T-CAGGCGTC GCCCTATCCC GCCCTGCAAC TGCTACAGTT 
0181 GCTCCACGAA CGGTCCAAAC TGCACATTGG ACAAATAATT TCCACCTTGC TTCGACAGCT 
0241 GCTA-GATGG CGATGTCGCA TCGCCGCG-T TCCCTTTGTG TGCTGGCCAA TTTTCCGGCA 
0301 AGCGTTTTGG AGGCCTCTAC ACTTCGTCAG AAATTGATGA CTCGTCTAGT GGTTGATTCC 
0361 ATAACCAGTG AACACTTAAT GCTGACCATG TTGGCGCGCA GCGATGGACA ACTCCTGGAT 
0421 GATCTGTTGC ATGAGCAGCA ACTGACCATG CGGGCGCAGT GTAGTGAGGC GGCGCCCACT 
0481 AAACTTTTGG TCCTGTGGCT GGC 
 Assemble Data

5270R-3.IR_full       1   CAGCAGGAGGAGAATATGCAGCAGCTGCTAAACTTGTTGCCCAAGGATCAGCGGCAGATC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5270R-3.in silico     1   CAGCAGGAGGAGAATATGCAGCAGCTGCTAAACTTGTTGCCCAAGGATCAGCGGCAGATC 60


5270R-3.IR_full       61  TTTGAGATCTTTATCCAGTGGCTCAATGGCAAGTCCTCCGGGCCCATTCAATTGCACCAG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5270R-3.in silico     61  TTTGAGATCTTTATCCAGTGGCTCAATGGCAAGTCCTCCGGGCCCATTCAATTGCACCAG 120


5270R-3.IR_full       121 AACGCCCTGCTAACCGTGCTTNCAGGCGTCGCCCTATCCCGCCCTGCAACTGCTACAGTT 180
                          ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
5270R-3.in silico     121 AACGCCCTGCTAACCGTGCTT-CAGGCGTCGCCCTATCCCGCCCTGCAACTGCTACAGTT 180


5270R-3.IR_full       181 GCTCCACGAACGGTCCAAACTGCACATTGGACAAATAATTTCCACCTTGCTTCGACAGCT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5270R-3.in silico     181 GCTCCACGAACGGTCCAAACTGCACATTGGACAAATAATTTCCACCTTGCTTCGACAGCT 240


5270R-3.IR_full       241 GCTANGATGGCGATGTCGCATCGCCGCGNTTCCCTTTGTGTGCTGGCCAATTTTCCGGCA 300
                          |||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||
5270R-3.in silico     241 GCTA-GATGGCGATGTCGCATCGCCGCG-TTCCCTTTGTGTGCTGGCCAATTTTCCGGCA 300


5270R-3.IR_full       301 AGCGTTTTGGAGGCCTCTACACTTCGTCAGAAATTGATGACTCGTCTAGTGGTTGATTCC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5270R-3.in silico     301 AGCGTTTTGGAGGCCTCTACACTTCGTCAGAAATTGATGACTCGTCTAGTGGTTGATTCC 360


5270R-3.IR_full       361 ATAACCAGTGAACACTTAATGCTGACCATGTTGGCGCGCAGCGATGGACAACTCCTGGAT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5270R-3.in silico     361 ATAACCAGTGAACACTTAATGCTGACCATGTTGGCGCGCAGCGATGGACAACTCCTGGAT 420


5270R-3.IR_full       421 GATCTGTTGCATGAGCAGCAACTGACCATGCGGGCGCAGTGTAGTGAGGCGGCGCCCACT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5270R-3.in silico     421 GATCTGTTGCATGAGCAGCAACTGACCATGCGGGCGCAGTGTAGTGAGGCGGCGCCCACT 480


5270R-3.IR_full       481 AAACTTTTGGTCCTGTGGCTGGC 503
                          |||||||||||||||||||||||
5270R-3.in silico     481 AAACTTTTGGTCCTGTGGCTGGC 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_169389.2  CG5270-RB, transcript variant B (CG5270), mRNA 
0.82   NM_134600.1  CG1494-RA (CG1494), mRNA 
0   NM_139783.1  CG10226-RA (CG10226), mRNA 
0   NM_080010.2  CG11606-RA (Rpp30), mRNA 
0   NM_170287.1  CG5490-RA, transcript variant A (Tl), mRNA 
0   NM_079794.2  CG5490-RB, transcript variant B (Tl), mRNA 
0   NM_133156.1  CG12202-RA (Nat1), mRNA 
0   NM_078846.2  CG4182-RA (yellow-c), mRNA 
0   NM_080199.2  CG4180-RA (l(2)35Bg), mRNA 
0   NM_165156.1  CG5813-RB, transcript variant B (chif), mRNA 
0   NM_078859.2  CG5813-RA, transcript variant A (chif), mRNA 
0   NM_165841.1  CG9015-RB, transcript variant B (en), mRNA 
0   NM_078976.3  CG9015-RA, transcript variant A (en), mRNA 
0   16  NM_079205.3  CG7507-RA, transcript variant A (Dhc64C), mRNA 
0   11  NM_168103.1  CG7507-RB, transcript variant B (Dhc64C), mRNA 
0   11  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_132915.1  CG15865-RA (CG15865), mRNA 
0   NM_137477.2  CG5154-RA (Idgf5), mRNA 
0   NM_001038734.1  CG16902-RC (Hr4), mRNA 
0   NM_142524.2  CG6040-RA (CG6040), mRNA 
0   NM_001038740.1  CG32776-RD, transcript variant D (CG32776), mRNA 
0   NM_206622.2  CG32776-RB, transcript variant B (CG32776), mRNA 
0   NM_166996.2  CG32776-RA, transcript variant A (CG32776), mRNA 
0   NM_001038741.1  CG32776-RC, transcript variant C (CG32776), mRNA 
0   NM_166037.1  CG30071-RA (CG30071), mRNA 
0   NM_143285.1  CG6051-RA (CG6051), mRNA 
0   NM_170158.1  CG5794-RB, transcript variant B (CG5794), mRNA 
0   NM_143018.2  CG5794-RD, transcript variant D (CG5794), mRNA 
0   NM_080136.1  CG18104-RA (arg), mRNA 
0   NM_133116.1  CG14190-RA (CG14190), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.