National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5247R-3 
 Symbol Irbp  Full Name Inverted repeat-binding protein 
 CG No CG5247  Old CG No CG5247 
 Synonyms MUS309, mus309, DmBlm, Ku70, DmKu70, YPF1, dp70, IRBP, Ku, IRBP/Ku70, p70, YPF1beta, Ypf1b, CG5247, Irbp, ku70 
 Accession No (Link to NCBI) NM_080512.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AATCCGGAGAACGATGTGGACCTGCTGTCTGGGTCCGAGGACGAGGAGGATGTGTCCATG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AAGCGGGACTACCATGGGCGCGAGGCCATTCTGTTCGTGGTAGACGCCAATCTTCAGACA 120

                          |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| silico     121 GCCGGCGTGGAGCGCCTG-TTGGAGGCACTGAACATCATCCGGACGGCCTTTATATCCGG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ACTTCTGGTTAACGACAAGGACCTCATCGGACTCATCTTCGCCAACACCAAGCACAGTCC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GCCGCCGCTGGAAGCCAGTGCATTGGACAACATCGTAATGCCGGATAACTGCGCAGTGTT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CTTGCCCCTTCGCCAACTAACCAAACCCATTGTGGAGCACTATCTGGAATTCATGGGCGG 360

                          |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| silico     361 GGTGGAGACGCAGTTCGCCGATGTGTATGGCCTGGCGG-AACCCGATGGTCGCGGCAGGT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TTGACCTTATGATCCGGCTCTGCATCGAGATGCTGGAAAAGTGCGGCAAGAAGCTAAACA 480

5247R-3.IR_full       481 ACGCCAAGATCGCCTATGTCAC 502
                          |||||||||||||||||||||| silico     481 ACGCCAAGATCGCCTATGTCAC 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_080512.2  CG5247-RA (Irbp), mRNA 
0.41   NM_141072.2  CG7177-RA (CG7177), mRNA 
0.2   10  NM_164429.1  CG31666-RC, transcript variant C (CG31666), mRNA 
0.2   10  NM_164428.2  CG31666-RB, transcript variant B (CG31666), mRNA 
0.2   10  NM_134766.3  CG31666-RA, transcript variant A (CG31666), mRNA 
0.2   10  NM_164430.2  CG31666-RD, transcript variant D (CG31666), mRNA 
0   NM_079789.1  CG8365-RA (E(spl)), mRNA 
0   NM_143755.2  CG14813-RA (deltaCOP), mRNA 
0   NM_143281.1  CG6066-RA (CG6066), mRNA 
0   NM_139778.2  CG10274-RA (CG10274), mRNA 
0   NM_079437.2  CG32211-RA (Taf6), mRNA 
0   NM_140174.4  CG7839-RA (CG7839), mRNA 
0   NM_130725.2  CG15239-RA (CG15239), mRNA 
0   NM_132313.1  CG15368-RA (CG15368), mRNA 
0   NM_165678.2  CG1884-RB, transcript variant B (Not1), mRNA 
0   NM_136653.3  CG1884-RA, transcript variant A (Not1), mRNA 
0   NM_135393.2  CG13097-RA (CG13097), mRNA 
0   NM_080094.2  CG9696-RA, transcript variant A (dom), mRNA 
0   NM_166446.1  CG9696-RD, transcript variant D (dom), mRNA 
0   NM_176244.1  CG9696-RE, transcript variant E (dom), mRNA 
0   NM_136895.2  CG13176-RA (CG13176), mRNA 
0   NM_078843.4  CG3479-RB, transcript variant B (osp), mRNA 
0   NM_165089.2  CG3479-RA, transcript variant A (osp), mRNA 
0   NM_079782.2  CG8337-RA (malpha), mRNA 
0   NM_078606.3  CG6146-RA, transcript variant A (Top1), mRNA 
0   NM_001014742.1  CG6146-RC, transcript variant C (Top1), mRNA 
0   NM_166567.1  CG3682-RB, transcript variant B (PIP5K59B), mRNA 
0   NM_137885.2  CG3682-RA, transcript variant A (PIP5K59B), mRNA 
0   NM_170032.2  CG5248-RB, transcript variant B (loco), mRNA 
0   NM_001043101.1  CG3682-RC, transcript variant C (PIP5K59B), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.