National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5247R-2 
 Symbol Irbp  Full Name Inverted repeat-binding protein 
 CG No CG5247  Old CG No CG5247 
 Synonyms MUS309, mus309, DmBlm, Ku70, DmKu70, YPF1, dp70, IRBP, Ku, IRBP/Ku70, p70, YPF1beta, Ypf1b, CG5247, Irbp, ku70 
 Accession No (Link to NCBI) NM_080512.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Lindström R, Lindholm P, Palgi M, Saarma M, Heino TI.
In vivo screening reveals interactions between Drosophila Manf and genes involved in the mitochondria and the ubiquinone synthesis pathway.
BMC Genet. (2017) 18(1) 52 [ PubMed ID = 28578657 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAATCCGGAGAACGATGTGGAC 
 Primer Seq. 3'
aatctagaggtaccGTGACATAGGCGATCTTGGCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AATCCGGAGA ACGATGTGGA CCTGCTGTCT GGGTCCGAGG ACGAGGAGGA TGTGTCCATG 
0061 AAGCGGGACT ACCATGGGCG CGAGGCCATT CTGTTCGTGG TAGACGCCAA TCTTCAGACA 
0121 GCCGGCGTGG AGCGCCTGNT TGGAGGCACT GAACATCATC CGGACGGCCT TTATATCCGG 
0181 ACTTCTGGTT AACGACAAGG ACCTCATCGG ACTCATCTTC GCCAACACCA AGCACAGTCC 
0241 GCCGCCGCTG GAAGCCAGTG CATTGGACAA CATCGTAATG CCGGATAACT GCGCAGTGTT 
0301 CTTGCCCCTT CGCCAACTAA CCAAACCCAT TGTGGAGCAC TATCTGGAAT TCATGGGCGG 
0361 GGTGGAGACG CAGTTCGCCG ATGTGTATGG CCTGGCGGAA ACCCGATGGT CGCGGCAGGT 
0421 TTGACCTTAT GATCCgGCTC TGCATCGAGA TGCTGGAAAA GTGCGGCAAG AAGCTAAACA 
0481 ACGCCAAGAT CGCCTATGTC AC 
 in silico PCR Fragment
0001 AATCCGGAGA ACGATGTGGA CCTGCTGTCT GGGTCCGAGG ACGAGGAGGA TGTGTCCATG 
0061 AAGCGGGACT ACCATGGGCG CGAGGCCATT CTGTTCGTGG TAGACGCCAA TCTTCAGACA 
0121 GCCGGCGTGG AGCGCCTG-T TGGAGGCACT GAACATCATC CGGACGGCCT TTATATCCGG 
0181 ACTTCTGGTT AACGACAAGG ACCTCATCGG ACTCATCTTC GCCAACACCA AGCACAGTCC 
0241 GCCGCCGCTG GAAGCCAGTG CATTGGACAA CATCGTAATG CCGGATAACT GCGCAGTGTT 
0301 CTTGCCCCTT CGCCAACTAA CCAAACCCAT TGTGGAGCAC TATCTGGAAT TCATGGGCGG 
0361 GGTGGAGACG CAGTTCGCCG ATGTGTATGG CCTGGCGG-A ACCCGATGGT CGCGGCAGGT 
0421 TTGACCTTAT GATCCGGCTC TGCATCGAGA TGCTGGAAAA GTGCGGCAAG AAGCTAAACA 
0481 ACGCCAAGAT CGCCTATGTC AC 
 Assemble Data

5247R-2.IR_full       1   AATCCGGAGAACGATGTGGACCTGCTGTCTGGGTCCGAGGACGAGGAGGATGTGTCCATG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5247R-2.in silico     1   AATCCGGAGAACGATGTGGACCTGCTGTCTGGGTCCGAGGACGAGGAGGATGTGTCCATG 60


5247R-2.IR_full       61  AAGCGGGACTACCATGGGCGCGAGGCCATTCTGTTCGTGGTAGACGCCAATCTTCAGACA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5247R-2.in silico     61  AAGCGGGACTACCATGGGCGCGAGGCCATTCTGTTCGTGGTAGACGCCAATCTTCAGACA 120


5247R-2.IR_full       121 GCCGGCGTGGAGCGCCTGNTTGGAGGCACTGAACATCATCCGGACGGCCTTTATATCCGG 180
                          |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
5247R-2.in silico     121 GCCGGCGTGGAGCGCCTG-TTGGAGGCACTGAACATCATCCGGACGGCCTTTATATCCGG 180


5247R-2.IR_full       181 ACTTCTGGTTAACGACAAGGACCTCATCGGACTCATCTTCGCCAACACCAAGCACAGTCC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5247R-2.in silico     181 ACTTCTGGTTAACGACAAGGACCTCATCGGACTCATCTTCGCCAACACCAAGCACAGTCC 240


5247R-2.IR_full       241 GCCGCCGCTGGAAGCCAGTGCATTGGACAACATCGTAATGCCGGATAACTGCGCAGTGTT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5247R-2.in silico     241 GCCGCCGCTGGAAGCCAGTGCATTGGACAACATCGTAATGCCGGATAACTGCGCAGTGTT 300


5247R-2.IR_full       301 CTTGCCCCTTCGCCAACTAACCAAACCCATTGTGGAGCACTATCTGGAATTCATGGGCGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5247R-2.in silico     301 CTTGCCCCTTCGCCAACTAACCAAACCCATTGTGGAGCACTATCTGGAATTCATGGGCGG 360


5247R-2.IR_full       361 GGTGGAGACGCAGTTCGCCGATGTGTATGGCCTGGCGGAAACCCGATGGTCGCGGCAGGT 420
                          |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
5247R-2.in silico     361 GGTGGAGACGCAGTTCGCCGATGTGTATGGCCTGGCGG-AACCCGATGGTCGCGGCAGGT 420


5247R-2.IR_full       421 TTGACCTTATGATCCGGCTCTGCATCGAGATGCTGGAAAAGTGCGGCAAGAAGCTAAACA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5247R-2.in silico     421 TTGACCTTATGATCCGGCTCTGCATCGAGATGCTGGAAAAGTGCGGCAAGAAGCTAAACA 480


5247R-2.IR_full       481 ACGCCAAGATCGCCTATGTCAC 502
                          ||||||||||||||||||||||
5247R-2.in silico     481 ACGCCAAGATCGCCTATGTCAC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_080512.2  CG5247-RA (Irbp), mRNA 
0.41   NM_141072.2  CG7177-RA (CG7177), mRNA 
0.2   10  NM_164429.1  CG31666-RC, transcript variant C (CG31666), mRNA 
0.2   10  NM_164428.2  CG31666-RB, transcript variant B (CG31666), mRNA 
0.2   10  NM_134766.3  CG31666-RA, transcript variant A (CG31666), mRNA 
0.2   10  NM_164430.2  CG31666-RD, transcript variant D (CG31666), mRNA 
0   NM_079789.1  CG8365-RA (E(spl)), mRNA 
0   NM_143755.2  CG14813-RA (deltaCOP), mRNA 
0   NM_143281.1  CG6066-RA (CG6066), mRNA 
0   NM_139778.2  CG10274-RA (CG10274), mRNA 
0   NM_079437.2  CG32211-RA (Taf6), mRNA 
0   NM_140174.4  CG7839-RA (CG7839), mRNA 
0   NM_130725.2  CG15239-RA (CG15239), mRNA 
0   NM_132313.1  CG15368-RA (CG15368), mRNA 
0   NM_165678.2  CG1884-RB, transcript variant B (Not1), mRNA 
0   NM_136653.3  CG1884-RA, transcript variant A (Not1), mRNA 
0   NM_135393.2  CG13097-RA (CG13097), mRNA 
0   NM_080094.2  CG9696-RA, transcript variant A (dom), mRNA 
0   NM_166446.1  CG9696-RD, transcript variant D (dom), mRNA 
0   NM_176244.1  CG9696-RE, transcript variant E (dom), mRNA 
0   NM_136895.2  CG13176-RA (CG13176), mRNA 
0   NM_078843.4  CG3479-RB, transcript variant B (osp), mRNA 
0   NM_165089.2  CG3479-RA, transcript variant A (osp), mRNA 
0   NM_079782.2  CG8337-RA (malpha), mRNA 
0   NM_078606.3  CG6146-RA, transcript variant A (Top1), mRNA 
0   NM_001014742.1  CG6146-RC, transcript variant C (Top1), mRNA 
0   NM_166567.1  CG3682-RB, transcript variant B (PIP5K59B), mRNA 
0   NM_137885.2  CG3682-RA, transcript variant A (PIP5K59B), mRNA 
0   NM_170032.2  CG5248-RB, transcript variant B (loco), mRNA 
0   NM_001043101.1  CG3682-RC, transcript variant C (PIP5K59B), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.