National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5242R-1 
 Symbol mRpL40  Full Name mitochondrial ribosomal protein L40 
 CG No CG5242  Old CG No CG5242 
 Synonyms CG5242, MRPL22(24), mRpL22-24, mRpL40 
 Accession No (Link to NCBI) NM_079594.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCTGCAGAGAAGTGGCGGCGT 
 Primer Seq. 3'
aatctagaggtaccCCTTAATGGGGGGCGTGGCAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCTGCAGAGA AGTGGCGGCG TCNCCGGTGC CGCCTTTGCA CGTTGCCTCC ACACGACACC 
0061 AGTTCTTTGT GCGCGAGCCC CTGAAGAAAA AGAAGAAACT GGATCCGCAG ATTGTCAAGC 
0121 AGCGCGAGGA TCGCAAGAAG AAGAAGATCG AGAAGCAGAT TCGCCGGCTG GAGAAGAATG 
0181 CCCGTCAGCT GAAGCCCGTG GATGAACTGG AGGTTCCACT GGAGCTCATC GACGAAAAGG 
0241 ACAAACGGCA GCGGAAGCTA GCNTCCACTG ACCATCGACC AGTTGGAGGA ACGTGCTCTC 
0301 CTCAAGAAGC AGTGGGCGCA CTACAAGCAC GACGAGCGCG TAGCAGNACT TTTCAGATCA 
0361 TCGACCGGCT GGTCCAGGCG CAAAACAAGG CGCTGGCGGA ACTTCGGCGC GAGTCCGAGG 
0421 AGCTCTACCA GGCGGCCATC GATATCGATC CCCAGCTGCT GCCCGTCGCC GTCAAAGGAC 
0481 CCGTTGCCAC GCCCCCCATT AAGG 
 in silico PCR Fragment
0001 TCTGCAGAGA AGTGGCGGCG TCGCCGGTGC CGCCTTTGCA CGTTGCCTCC ACACGACACC 
0061 AGTTCTTTGT GCG-GAGCCC CTGAAGAAAA AGAAGAAACT GGATCCGCAG ATTGTCAAGC 
0121 AGCGCGAGGA TCGCAAGAAG AAGAAGATCG AAAAGCAGAT TCGCCGGCTG GAGAAGAATG 
0181 CCCGTCAGCT GAAGCCCGTG GATGAACTGG AGGTTCCACT GGAGCTCATC GACGAAAAGG 
0241 ACAAACGGCA GCGGAAGCTA GC-TCCACTG ACCATCGACC AGTTGGAGGA ACGTGCTCTC 
0301 CTCAAGAAGC AGTGGGCGCA CTACAAGCAC GACGAGCGCG TAGCAG-AC- TTTCAGATCA 
0361 TCGACCGGCT GGTCCAGGCG CAAAACAAGG CGCTGGCGGA ACTTCGGCGC GAGTCCGAGG 
0421 AGCTCTACCA GGCGGCCATC GATATCGATC CCCAGCTGCT GCCCGTCGCC GTCAAAGGAC 
0481 CCGTTGCCAC GCCCCCCATT AAGG 
 Assemble Data

5242R-1.IR_full       1   TCTGCAGAGAAGTGGCGGCGTCNCCGGTGCCGCCTTTGCACGTTGCCTCCACACGACACC 60
                          |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
5242R-1.in silico     1   TCTGCAGAGAAGTGGCGGCGTCGCCGGTGCCGCCTTTGCACGTTGCCTCCACACGACACC 60


5242R-1.IR_full       61  AGTTCTTTGTGCGCGAGCCCCTGAAGAAAAAGAAGAAACTGGATCCGCAGATTGTCAAGC 120
                          ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
5242R-1.in silico     61  AGTTCTTTGTGCG-GAGCCCCTGAAGAAAAAGAAGAAACTGGATCCGCAGATTGTCAAGC 120


5242R-1.IR_full       121 AGCGCGAGGATCGCAAGAAGAAGAAGATCGAGAAGCAGATTCGCCGGCTGGAGAAGAATG 180
                          ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
5242R-1.in silico     121 AGCGCGAGGATCGCAAGAAGAAGAAGATCGAAAAGCAGATTCGCCGGCTGGAGAAGAATG 180


5242R-1.IR_full       181 CCCGTCAGCTGAAGCCCGTGGATGAACTGGAGGTTCCACTGGAGCTCATCGACGAAAAGG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5242R-1.in silico     181 CCCGTCAGCTGAAGCCCGTGGATGAACTGGAGGTTCCACTGGAGCTCATCGACGAAAAGG 240


5242R-1.IR_full       241 ACAAACGGCAGCGGAAGCTAGCNTCCACTGACCATCGACCAGTTGGAGGAACGTGCTCTC 300
                          |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
5242R-1.in silico     241 ACAAACGGCAGCGGAAGCTAGC-TCCACTGACCATCGACCAGTTGGAGGAACGTGCTCTC 300


5242R-1.IR_full       301 CTCAAGAAGCAGTGGGCGCACTACAAGCACGACGAGCGCGTAGCAGNACTTTTCAGATCA 360
                          |||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||
5242R-1.in silico     301 CTCAAGAAGCAGTGGGCGCACTACAAGCACGACGAGCGCGTAGCAG-AC-TTTCAGATCA 360


5242R-1.IR_full       361 TCGACCGGCTGGTCCAGGCGCAAAACAAGGCGCTGGCGGAACTTCGGCGCGAGTCCGAGG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5242R-1.in silico     361 TCGACCGGCTGGTCCAGGCGCAAAACAAGGCGCTGGCGGAACTTCGGCGCGAGTCCGAGG 420


5242R-1.IR_full       421 AGCTCTACCAGGCGGCCATCGATATCGATCCCCAGCTGCTGCCCGTCGCCGTCAAAGGAC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5242R-1.in silico     421 AGCTCTACCAGGCGGCCATCGATATCGATCCCCAGCTGCTGCCCGTCGCCGTCAAAGGAC 480


5242R-1.IR_full       481 CCGTTGCCACGCCCCCCATTAAGG 504
                          ||||||||||||||||||||||||
5242R-1.in silico     481 CCGTTGCCACGCCCCCCATTAAGG 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079594.2  CG5242-RA (mRpL40), mRNA 
0.2   13  NM_138040.2  CG3231-RA (CG3231), mRNA 
0.2   NM_136508.2  CG8711-RA (cul-4), mRNA 
0.2   NM_140999.2  CG3871-RA, transcript variant A (Six4), mRNA 
0.2   NM_168872.1  CG3871-RB, transcript variant B (Six4), mRNA 
0   NM_078872.4  CG10302-RA (bsf), mRNA 
0   NM_143048.1  CG11089-RA (CG11089), mRNA 
0   10  NM_001014591.1  CG8103-RB, transcript variant B (Mi-2), mRNA 
0   10  NM_140897.2  CG8103-RA, transcript variant A (Mi-2), mRNA 
0   NM_137272.1  CG3896-RA (Nox), mRNA 
0   10  NM_132320.2  CG12124-RA (CG12124), mRNA 
0   NM_139732.2  CG10542-RA (CG10542), mRNA 
0   NM_168231.1  CG32371-RA (CG32371), mRNA 
0   NM_078698.2  CG1676-RA (cactin), mRNA 
0   13  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   13  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   NM_135018.1  CG2976-RA (CG2976), mRNA 
0   NM_001043084.1  CG34123-RD, transcript variant D (CG34123), mRNA 
0   NM_001043083.1  CG34123-RB, transcript variant B (CG34123), mRNA 
0   NM_001043085.1  CG34123-RC, transcript variant C (CG34123), mRNA 
0   NM_078902.2  CG8276-RB, transcript variant B (bin3), mRNA 
0   NM_165468.1  CG8276-RA, transcript variant A (bin3), mRNA 
0   NM_169443.2  CG12201-RB, transcript variant B (CG12201), mRNA 
0   NM_141878.2  CG12201-RA, transcript variant A (CG12201), mRNA 
0   NM_137557.2  CG7229-RA (CG7229), mRNA 
0   NM_001014474.2  CG33531-RA (Ddr), mRNA 
0   NM_205934.1  CG13391-RB, transcript variant B (Aats-ala), mRNA 
0   NM_078787.2  CG13391-RA, transcript variant A (Aats-ala), mRNA 
0   NM_134490.2  CG12238-RA (l(1)G0084), mRNA 
0   NM_130641.2  CG2865-RA (CG2865), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.