National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5232R-3 
 Symbol Sas  Full Name Sialic acid phosphate synthase 
 CG No CG5232  Old CG No CG5232 
 Synonyms CG5232, DmSAS, Neu5Ac, Sas 
 Accession No (Link to NCBI) NM_141938.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GGAGTACCTGGAGTTCTCCAAAGATCAGTATCTCCAGCTGCAGGCCCACTGCAAGGAGTT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AAATGTGGACTTTACGGCTTCCGCCATGGATGAGAGATCGTTGGAGTTCCTTTCTGCTCT 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AAATGTTCCCTTCATCAAAATTGGTTCCGGAGACGCAAACAACTTTCCGCTTCTCAAAAA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GGCCGCCAATTTGAACTTGCCCCTGGTGATCTCCACCGGAATGCAGACTATGCAAACTGT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GGAGAGGATTGTGCAAACTATGCGGGAGTCAGGAAAAGAGGACTACGCTCTAATGCACTG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CGTTTCATCGTACCCAACTGACCCAAAAGATTGCAGCTTGCAGTTGATATCCGTCTTAAG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GACACGCTTTCCCAATGTGGCAATTGGGTACTCGGGTCATGAGCTGGGAGTGATCATTAG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CCAGGCCGCCGTCTTGCTGGGAGCACGCATAGTGGAGCGCCACTTTACGCTGGACAAGAG 480

5232R-3.IR_full       481 TCAGAAGGGCTCCGATCATC 500
                          |||||||||||||||||||| silico     481 TCAGAAGGGCTCCGATCATC 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141938.1  CG5232-RA (Sas), mRNA 
0   NM_140424.1  CG9007-RA (CG9007), mRNA 
0   NM_143557.2  CG31017-RA (PH4alphaNE3), mRNA 
0   14  NM_132068.1  CG15899-RB (Ca-alpha1T), mRNA 
0   NM_080342.2  CG1787-RA (Hexo2), mRNA 
0   NM_169991.1  CG6375-RB, transcript variant B (pit), mRNA 
0   NM_079722.2  CG6375-RA, transcript variant A (pit), mRNA 
0   NM_057511.3  CG3936-RA (N), mRNA 
0   NM_135363.2  CG7806-RA (CG7806), mRNA 
0   NM_137763.3  CG17922-RA (CG17922), mRNA 
0   NM_142663.3  CG15695-RA (CG15695), mRNA 
0   NM_135261.1  CG4567-RA (CG4567), mRNA 
0   NM_079100.2  CG17632-RA (bw), mRNA 
0   NM_136658.1  CG12929-RA (CG12929), mRNA 
0   NM_079334.2  CG10717-RA, transcript variant A (ImpL1), mRNA 
0   NM_168541.1  CG10717-RB, transcript variant B (ImpL1), mRNA 
0   NM_132760.3  CG9009-RA (CG9009), mRNA 
0   NM_140977.1  CG6020-RA (CG6020), mRNA 
0   NM_139827.1  CG17742-RA (CG17742), mRNA 
0   NM_142786.1  CG13847-RA (CG13847), mRNA 
0   NM_168470.1  CG32085-RA (CG32085), mRNA 
0   NM_136797.2  CG7737-RA (CG7737), mRNA 
0   NM_001032265.1  CG4844-RA, transcript variant A (CG4844), mRNA 
0   NM_001032264.1  CG4844-RB, transcript variant B (CG4844), mRNA 
0   NM_001032266.1  CG18431-RA, transcript variant A (CG18431), mRNA 
0   NM_057414.3  CG1389-RA (tor), mRNA 
0   NM_137054.1  CG6280-RA (CG6280), mRNA 
0   NM_170253.2  CG8318-RB, transcript variant B (Nf1), mRNA 
0   NM_170252.2  CG8318-RC, transcript variant C (Nf1), mRNA 
0   NM_001014668.1  CG8318-RD, transcript variant D (Nf1), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.