National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5232R-1 
 Symbol Sas  Full Name Sialic acid phosphate synthase 
 CG No CG5232  Old CG No CG5232 
 Synonyms CG5232, DmSAS, Neu5Ac, Sas 
 Accession No (Link to NCBI) NM_141938.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGAGTACCTGGAGTTCTCCAA 
 Primer Seq. 3'
aatctagaggtaccGATGATCGGAGCCCTTCTGAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGAGTACCTG GAGTTCTCCA AAGATCAGTA TCTCCAGCTG CAGGCCCACT GCAAGGAGTT 
0061 AAATGTGGAC TTTACGGCTT CCGCCATGGA TGAGAGATCG TTGGAGTTCC TTTCTGCTCT 
0121 AAATGTTCCC TTCATCAAAA TTGGTTCCGG AGACGCAAAC AACTTTCCGC TTCTCAAAAA 
0181 GGCCGCCAAT TTGAACTTGC CCCTGGTGAT CTCCACCGGA ATGCAGACTA TGCAAACTGT 
0241 GGAGAGGATT GTGCAAACTA TGCGGGAGTC AGGAAAAGAG GACTACGCTC TAATGCACTG 
0301 CGTTTCATCG TACCCAACTG ACCCAAAAGA TTGCAGCTTG CAGTTGATAT CCGTCTTAAG 
0361 GACACGCTTT CCCAATGTGG CAATTGGGTA CTCGGGTCAT GAGCTGGGAG TGATCATTAG 
0421 CCAGGCCGCC GTCTTGCTGG GAGCACGCAT AGTGGAGCGC CACTTTACGC TGGACAAGAG 
0481 TCAGAAGGGC TCCGATCATC  
 in silico PCR Fragment
0001 GGAGTACCTG GAGTTCTCCA AAGATCAGTA TCTCCAGCTG CAGGCCCACT GCAAGGAGTT 
0061 AAATGTGGAC TTTACGGCTT CCGCCATGGA TGAGAGATCG TTGGAGTTCC TTTCTGCTCT 
0121 AAATGTTCCC TTCATCAAAA TTGGTTCCGG AGACGCAAAC AACTTTCCGC TTCTCAAAAA 
0181 GGCCGCCAAT TTGAACTTGC CCCTGGTGAT CTCCACCGGA ATGCAGACTA TGCAAACTGT 
0241 GGAGAGGATT GTGCAAACTA TGCGGGAGTC AGGAAAAGAG GACTACGCTC TAATGCACTG 
0301 CGTTTCATCG TACCCAACTG ACCCAAAAGA TTGCAGCTTG CAGTTGATAT CCGTCTTAAG 
0361 GACACGCTTT CCCAATGTGG CAATTGGGTA CTCGGGTCAT GAGCTGGGAG TGATCATTAG 
0421 CCAGGCCGCC GTCTTGCTGG GAGCACGCAT AGTGGAGCGC CACTTTACGC TGGACAAGAG 
0481 TCAGAAGGGC TCCGATCATC  
 Assemble Data

5232R-1.IR_full       1   GGAGTACCTGGAGTTCTCCAAAGATCAGTATCTCCAGCTGCAGGCCCACTGCAAGGAGTT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5232R-1.in silico     1   GGAGTACCTGGAGTTCTCCAAAGATCAGTATCTCCAGCTGCAGGCCCACTGCAAGGAGTT 60


5232R-1.IR_full       61  AAATGTGGACTTTACGGCTTCCGCCATGGATGAGAGATCGTTGGAGTTCCTTTCTGCTCT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5232R-1.in silico     61  AAATGTGGACTTTACGGCTTCCGCCATGGATGAGAGATCGTTGGAGTTCCTTTCTGCTCT 120


5232R-1.IR_full       121 AAATGTTCCCTTCATCAAAATTGGTTCCGGAGACGCAAACAACTTTCCGCTTCTCAAAAA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5232R-1.in silico     121 AAATGTTCCCTTCATCAAAATTGGTTCCGGAGACGCAAACAACTTTCCGCTTCTCAAAAA 180


5232R-1.IR_full       181 GGCCGCCAATTTGAACTTGCCCCTGGTGATCTCCACCGGAATGCAGACTATGCAAACTGT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5232R-1.in silico     181 GGCCGCCAATTTGAACTTGCCCCTGGTGATCTCCACCGGAATGCAGACTATGCAAACTGT 240


5232R-1.IR_full       241 GGAGAGGATTGTGCAAACTATGCGGGAGTCAGGAAAAGAGGACTACGCTCTAATGCACTG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5232R-1.in silico     241 GGAGAGGATTGTGCAAACTATGCGGGAGTCAGGAAAAGAGGACTACGCTCTAATGCACTG 300


5232R-1.IR_full       301 CGTTTCATCGTACCCAACTGACCCAAAAGATTGCAGCTTGCAGTTGATATCCGTCTTAAG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5232R-1.in silico     301 CGTTTCATCGTACCCAACTGACCCAAAAGATTGCAGCTTGCAGTTGATATCCGTCTTAAG 360


5232R-1.IR_full       361 GACACGCTTTCCCAATGTGGCAATTGGGTACTCGGGTCATGAGCTGGGAGTGATCATTAG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5232R-1.in silico     361 GACACGCTTTCCCAATGTGGCAATTGGGTACTCGGGTCATGAGCTGGGAGTGATCATTAG 420


5232R-1.IR_full       421 CCAGGCCGCCGTCTTGCTGGGAGCACGCATAGTGGAGCGCCACTTTACGCTGGACAAGAG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5232R-1.in silico     421 CCAGGCCGCCGTCTTGCTGGGAGCACGCATAGTGGAGCGCCACTTTACGCTGGACAAGAG 480


5232R-1.IR_full       481 TCAGAAGGGCTCCGATCATC 500
                          ||||||||||||||||||||
5232R-1.in silico     481 TCAGAAGGGCTCCGATCATC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141938.1  CG5232-RA (Sas), mRNA 
0   NM_140424.1  CG9007-RA (CG9007), mRNA 
0   NM_143557.2  CG31017-RA (PH4alphaNE3), mRNA 
0   14  NM_132068.1  CG15899-RB (Ca-alpha1T), mRNA 
0   NM_080342.2  CG1787-RA (Hexo2), mRNA 
0   NM_169991.1  CG6375-RB, transcript variant B (pit), mRNA 
0   NM_079722.2  CG6375-RA, transcript variant A (pit), mRNA 
0   NM_057511.3  CG3936-RA (N), mRNA 
0   NM_135363.2  CG7806-RA (CG7806), mRNA 
0   NM_137763.3  CG17922-RA (CG17922), mRNA 
0   NM_142663.3  CG15695-RA (CG15695), mRNA 
0   NM_135261.1  CG4567-RA (CG4567), mRNA 
0   NM_079100.2  CG17632-RA (bw), mRNA 
0   NM_136658.1  CG12929-RA (CG12929), mRNA 
0   NM_079334.2  CG10717-RA, transcript variant A (ImpL1), mRNA 
0   NM_168541.1  CG10717-RB, transcript variant B (ImpL1), mRNA 
0   NM_132760.3  CG9009-RA (CG9009), mRNA 
0   NM_140977.1  CG6020-RA (CG6020), mRNA 
0   NM_139827.1  CG17742-RA (CG17742), mRNA 
0   NM_142786.1  CG13847-RA (CG13847), mRNA 
0   NM_168470.1  CG32085-RA (CG32085), mRNA 
0   NM_136797.2  CG7737-RA (CG7737), mRNA 
0   NM_001032265.1  CG4844-RA, transcript variant A (CG4844), mRNA 
0   NM_001032264.1  CG4844-RB, transcript variant B (CG4844), mRNA 
0   NM_001032266.1  CG18431-RA, transcript variant A (CG18431), mRNA 
0   NM_057414.3  CG1389-RA (tor), mRNA 
0   NM_137054.1  CG6280-RA (CG6280), mRNA 
0   NM_170253.2  CG8318-RB, transcript variant B (Nf1), mRNA 
0   NM_170252.2  CG8318-RC, transcript variant C (Nf1), mRNA 
0   NM_001014668.1  CG8318-RD, transcript variant D (Nf1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.