National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5217R-4 
 Symbol CG5217  Full Name CG5217 
 CG No CG5217  Old CG No CG5217 
 Synonyms anon-WO0140519.188, CG5217 
 Accession No (Link to NCBI) NM_142539.2 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAAGATATTCCGCTTGCCGAC 
 Primer Seq. 3'
aatctagaggtaccCGTTCCATTTCATCGTGCTCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CAAGATATTC CGCTTGCCGA CCCCGAgGGC CTGTCTGTGG AAGGTCCCGA GGTGGCCCCC 
0061 GCTCCAAAGT CCAATTCCTT GAAGCGCTTC TTTAAGATCA GCAAGAAGCC AATGATGCGC 
0121 GACCAAGTGG AGGATGACGA CGAGACATCC TcCCAGGACA ACAAGNACCT GGGAAAGTCA 
0181 AACACTATAA GTCGCTTCTT TACCCGGATG AAGGGAGCCA ATAAGGATGT TCAAGATCCT 
0241 TCGAGCTCGG TGGTCGAACC CGTGGAGCAG GATAAGCCGT TGCCGAATGC AAAGCCCACG 
0301 ATTAAGACAT CCATTTCATC CTACTGGAAG ATACTGTTCA ACCGGCAGAA GAGCCAGCGC 
0361 CAAAACGCAG CTTTAGGGCA GACCAATGCC AATAAAGAGG ATAACGAGTC TGAAGAAGTC 
0421 CATGAACTGC AACCAGTAAG CCAAGATCCC GATACCGATC CTCAGCCGAC AGTCAAGGAT 
0481 GAGCACGATG AAATGGAACG  
 in silico PCR Fragment
0001 CAAGATATTC CGCTTGCCGA CCCCGAGGGC CTGTCTGTGG AAGGTCCCGA GGTGGCCCCC 
0061 GCTCCAAAGT CCAATTCCTT GAAGCGCTTC TTTAAGATCA GCAAGAAGCC AATGATGCGC 
0121 GACCAAGTGG AGGATGACGA CGAGACATCC TCCCAGGACA ACAAGGACCT GGGAAAGTCA 
0181 AACACTATAA GTCGCTTCTT TACCCGGATG AAGGGAGCCA ATAAGGATGT TCAAGATCCT 
0241 TCGAGCTCGG TGGTCGAACC CGTGGAGCAG GATAAGCCGT TGCCGAATGC AAAGCCCACG 
0301 ATTAAGACAT CCATTTCATC CTACTGGAAG ATACTGTTCA ACCGGCAGAA GAGCCAGCGC 
0361 CAAAACGCAG CTTTAGGGCA GACCAATGCC AATAAAGAGG ATAACGAGTC TGAAGAAGTC 
0421 CATGAACTGC AACCAGTAAG CCAAGATCCC GATACCGATC CTCAGCCGAC AGTCAAGGAT 
0481 GAGCACGATG AAATGGAACG  
 Assemble Data

5217R-4.IR_full       1   CAAGATATTCCGCTTGCCGACCCCGAGGGCCTGTCTGTGGAAGGTCCCGAGGTGGCCCCC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5217R-4.in silico     1   CAAGATATTCCGCTTGCCGACCCCGAGGGCCTGTCTGTGGAAGGTCCCGAGGTGGCCCCC 60


5217R-4.IR_full       61  GCTCCAAAGTCCAATTCCTTGAAGCGCTTCTTTAAGATCAGCAAGAAGCCAATGATGCGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5217R-4.in silico     61  GCTCCAAAGTCCAATTCCTTGAAGCGCTTCTTTAAGATCAGCAAGAAGCCAATGATGCGC 120


5217R-4.IR_full       121 GACCAAGTGGAGGATGACGACGAGACATCCTCCCAGGACAACAAGNACCTGGGAAAGTCA 180
                          ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
5217R-4.in silico     121 GACCAAGTGGAGGATGACGACGAGACATCCTCCCAGGACAACAAGGACCTGGGAAAGTCA 180


5217R-4.IR_full       181 AACACTATAAGTCGCTTCTTTACCCGGATGAAGGGAGCCAATAAGGATGTTCAAGATCCT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5217R-4.in silico     181 AACACTATAAGTCGCTTCTTTACCCGGATGAAGGGAGCCAATAAGGATGTTCAAGATCCT 240


5217R-4.IR_full       241 TCGAGCTCGGTGGTCGAACCCGTGGAGCAGGATAAGCCGTTGCCGAATGCAAAGCCCACG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5217R-4.in silico     241 TCGAGCTCGGTGGTCGAACCCGTGGAGCAGGATAAGCCGTTGCCGAATGCAAAGCCCACG 300


5217R-4.IR_full       301 ATTAAGACATCCATTTCATCCTACTGGAAGATACTGTTCAACCGGCAGAAGAGCCAGCGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5217R-4.in silico     301 ATTAAGACATCCATTTCATCCTACTGGAAGATACTGTTCAACCGGCAGAAGAGCCAGCGC 360


5217R-4.IR_full       361 CAAAACGCAGCTTTAGGGCAGACCAATGCCAATAAAGAGGATAACGAGTCTGAAGAAGTC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5217R-4.in silico     361 CAAAACGCAGCTTTAGGGCAGACCAATGCCAATAAAGAGGATAACGAGTCTGAAGAAGTC 420


5217R-4.IR_full       421 CATGAACTGCAACCAGTAAGCCAAGATCCCGATACCGATCCTCAGCCGACAGTCAAGGAT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5217R-4.in silico     421 CATGAACTGCAACCAGTAAGCCAAGATCCCGATACCGATCCTCAGCCGACAGTCAAGGAT 480


5217R-4.IR_full       481 GAGCACGATGAAATGGAACG 500
                          ||||||||||||||||||||
5217R-4.in silico     481 GAGCACGATGAAATGGAACG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_142539.2  CG5217-RA (CG5217), mRNA 
0   NM_143298.1  CG3368-RA (CG3368), mRNA 
0   NM_079702.2  CG3637-RA (Cortactin), mRNA 
0   NM_134899.2  CG17259-RA (CG17259), mRNA 
0   10  NM_137751.3  CG10082-RB, transcript variant B (CG10082), mRNA 
0   NM_166466.2  CG10082-RA, transcript variant A (CG10082), mRNA 
0   NM_135364.1  CG7795-RA, transcript variant A (CG7795), mRNA 
0   NM_164806.1  CG7795-RB, transcript variant B (CG7795), mRNA 
0   NM_001042874.1  CG14034-RB (CG14034), mRNA 
0   NM_169500.1  CG8630-RA (CG8630), mRNA 
0   NM_001043240.1  CG34114-RB (CG34114), mRNA 
0   NM_142157.1  CG6974-RA (CG6974), mRNA 
0   NM_140626.1  CG12255-RA (CG12255), mRNA 
0   NM_058067.2  CG6147-RA (Tsc1), mRNA 
0   NM_001014552.1  CG15792-RD, transcript variant D (zip), mRNA 
0   NM_079136.2  CG15792-RA, transcript variant A (zip), mRNA 
0   NM_001014553.1  CG15792-RC, transcript variant C (zip), mRNA 
0   NM_166704.1  CG15792-RB, transcript variant B (zip), mRNA 
0   NM_079108.2  CG30170-RA (bgcn), mRNA 
0   NM_168788.2  CG9655-RB, transcript variant B (nes), mRNA 
0   NM_176349.1  CG9655-RC, transcript variant C (nes), mRNA 
0   NM_079433.2  CG9655-RA, transcript variant A (nes), mRNA 
0   NM_169850.1  CG5558-RB, transcript variant B (CG5558), mRNA 
0   NM_206236.1  CG15804-RB, transcript variant B (Dhc62B), mRNA 
0   NM_057737.2  CG15804-RA, transcript variant A (Dhc62B), mRNA 
0   NM_132790.1  CG9123-RA (CG9123), mRNA 
0   NM_166257.1  CG5785-RB (thr), mRNA 
0   NM_001038756.1  CG33968-RA (CG33968), mRNA 
0   NM_167903.1  CG7955-RB, transcript variant B (CG7955), mRNA 
0   NM_137372.2  CG6520-RA (CG6520), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.