National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5178R-2 
 Symbol Act88F  Full Name Actin 88F 
 CG No CG5178  Old CG No CG5178 
 Synonyms Actin, actin, E, act88F, CG5178, Act(88F), act 88F, Act88-F, Ifm(3)7, rsd, Act88F 
 Accession No (Link to NCBI) NM_079643.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTCCGGTCGTACCACCGGTAT 
 Primer Seq. 3'
aatctagaggtaccTACCGCCGGACAGCACAGAGT 
 Predicted Fragment Size
476 
 IR fragment full Seq
0001 CTCCgGTCGT ACCACCGGTA TTGTGCTGGA CTCCGGCGAT GGTGTCTCCC ACACCGTGCC 
0061 CATCTATGAG GGCTTcgcCC NGCNCCCACG CCATTCTGCG TCTGGATCTG GCTGGTCGCG 
0121 ATCTGACCGA TTACCTGATG AAGATCCTGA CGGAGCGCGG CTACAGCNTT CACCACCACC 
0181 GCCGAGCGTG AGATCGTGCG CGACATCAAG GAGAAGCTGT GCTACGTGGC TCTGGACTTC 
0241 GAGCAGGAGA TGGCCACCGC TGCCGCCTCC ACCTCGCTGG AGAAGTCGTA CGAGTTGCCT 
0301 GACGGCCAGG TGATCACCAT TGGCAANCGA GCGCTTCCGC TGCCCCGAGG CTCTGTTCCA 
0361 GCCCTCGTTC CTGGGCATGG AGTCGTGCGG CATCCACGAG ACCGTCTACA ACTCGATCAT 
0421 GAAGTGCGAC GTGGACATCC GCAAGGATCT GTATGCCAAC TCTGTGCTGT NCGGCGGTA 
 in silico PCR Fragment
0001 CTCCGGTCGT ACCACCGGTA TTGTGCTGGA CTCCGGCGAT GGTGTCTCCC ACACCGTGCC 
0061 CATCTATGAG GGCTTCGCCC TGC-CCCACG CCATTCTGCG TCTGGATCTG GCTGGTCGCG 
0121 ATCTGACCGA TTACCTGATG AAGATCCTGA CGGAGCGCGG CTACAGC-TT CACCACCACC 
0181 GCCGAGCGTG AGATCGTGCG CGACATCAAG GAGAAGCTGT GCTACGTGGC TCTGGACTTC 
0241 GAGCAGGAGA TGGCCACCGC TGCCGCCTCC ACCTCGCTGG AGAAGTCGTA CGAGTTGCCT 
0301 GACGGCCAGG TGATCACCAT TGGCAA-CGA GCGCTTCCGC TGCCCCGAGG CTCTGTTCCA 
0361 GCCCTCGTTC CTGGGCATGG AGTCGTGCGG CATCCACGAG ACCGTCTACA ACTCGATCAT 
0421 GAAGTGCGAC GTGGACATCC GCAAGGATCT GTATGCCAAC TCTGTGCTGT CCGGCGGTA 
 Assemble Data

5213R-2.IR_full       1   AGAAAGGAGTCATCCGTCCCCGACGCTGTGTTGGGGATACGCCGGGATACGCGGCATGTT 60
                          || |||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||
5213R-2.in silico     1   AG-AAGGAGTCATCCGT-CCCGACGCTATGTTGGGGATACGCCGGGATACGCGGCATGTT 60


5213R-2.IR_full       61  CCAANACTGGAAGACCAGTGGATCCGCCCCCTCCTCTCCCTAATTTGCGGATGAAGACGA 120
                          |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
5213R-2.in silico     61  CCAA-ACTGGAAGACCAGTGGATCCGCCCCCTCCTCTCCCTAATTTGCGGATGAAGACGA 120


5213R-2.IR_full       121 ACCTGATCCTCAACTACCTTCCGCAGGACATGACGGAGTCTGAGCTGCACCGTCTCTTCT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5213R-2.in silico     121 ACCTGATCCTCAACTACCTTCCGCAGGACATGACGGAGTCTGAGCTGCACCGTCTCTTCT 180


5213R-2.IR_full       181 CCAAGTTCGGTGAGATCCGCAAGGCCAAGATCATCCGCCACCGCAGGACTGGCATAAGCT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5213R-2.in silico     181 CCAAGTTCGGTGAGATCCGCAAGGCCAAGATCATCCGCCACCGCAGGACTGGCATAAGCT 240


5213R-2.IR_full       241 GTTGCTACGGATTCGTCGACTACGTGTCGGAACGCCAGGCGGCNTGCTGCCGTGNAATGG 300
                          ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||
5213R-2.in silico     241 GTTGCTACGGATTCGTCGACTACGTGTCGGAACGCCAGGCGGC-TGCTGCCGTG-AATGG 300


5213R-2.IR_full       301 CATGGATGGCTACGAGACTCGCGGCAAGCGACTGAAAGTGGCCTTCGCCCGACCTTCGGA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5213R-2.in silico     301 CATGGATGGCTACGAGACTCGCGGCAAGCGACTGAAAGTGGCCTTCGCCCGACCTTCGGA 360


5213R-2.IR_full       361 ATATGAAAGCACCAGCTCCAGCCTGTACGTGGGGAACCTGCCCACGTACATGGATGAGAA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5213R-2.in silico     361 ATATGAAAGCACCAGCTCCAGCCTGTACGTGGGGAACCTGCCCACGTACATGGATGAGAA 420


5213R-2.IR_full       421 GAAGGTACGAGAACTCTTCGCCACCTACGGCAACATCGTGGATGTGAANTTGCTGCGCCA 480
                          |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
5213R-2.in silico     421 GAAGGTACGAGAACTCTTCGCCACCTACGGCAACATCGTGGATGTGAACTTGCTGCGCCA 480


5213R-2.IR_full       481 CAAGTTCAACAATAGGTCCCGTGGN 505
                          |||||||||||||||||||||||| 
5213R-2.in silico     481 CAAGTTCAACAATAGGTCCCGTGGC 505

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.