National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5156R-1 
 Symbol CG5156  Full Name CG5156 
 CG No CG5156  Old CG No CG5156 
 Synonyms CT16503, CG5156 
 Accession No (Link to NCBI) NM_134746.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| silico     1   TTCTACTGGCGCCCACCATTAATGCTTACGATATCGTGGCCTGGGCTCAGATGCCCTTCT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CCATGATCCTCCAGAGCGGCACTACGTCTGTGGACACCTTCTTCCTGCTCAGTGGACTGC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TTCTGGTTCTGTCCGCCCTGCGTGAGATGGATCGCTCCAAGGGTCGTCTGCATGTGCCAC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TGATGTATCTGCACCGTCTGGTTCGCCTGACTCCTGTTTTGGCCCTGGCCGTGCTCATCT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TTATGACCCTTTTCCCCCGACTGGACAGTGGTCCTCTGTGGAATCAGTTCACCAGCTCAT 300

                          ||||  |||| ||||||||||||||||||||||||||||||||| |||||||| |||||| silico     301 CGGAGCTCTGCAGCGACACCTGGTGGGCAACTCTGCTCTACGTGCAAAATTATGCTGCTC 360

                          ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CTGGTAGGATGTGTCTGGGTCATTCGTGGTATCTGGCTGTGGATATGCAACTGTATATTA 420

                          |||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| silico     421 TATCCCCACTCCTTCTGATCGCCCTTTACAAATGGGGCAAAAAGGCTATCGCAGGAATTG 480

5156R-1.IR_full       481 TCCTGCTGATCCTTCTGCTG 500
                          |||||||||||||||||||| silico     481 TCCTGCTGATCCTTCTGCTG 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134746.1  CG5156-RA (CG5156), mRNA 
0   29  26  NM_134477.1  CG14204-RA (CG14204), mRNA 
0   14  NM_142903.2  CG10183-RA (CG10183), mRNA 
0   11  22  NM_132349.2  CG3106-RA (CG3106), mRNA 
0   NM_142839.1  CG4725-RA (CG4725), mRNA 
0   NM_142942.3  CG31140-RA, transcript variant A (CG31140), mRNA 
0   NM_206553.1  CG31140-RB, transcript variant B (CG31140), mRNA 
0   NM_206552.1  CG31140-RC, transcript variant C (CG31140), mRNA 
0   NM_135278.1  CG6055-RA (CG6055), mRNA 
0   NM_168667.1  CG32159-RB (CG32159), mRNA 
0   NM_169682.1  CG31291-RB, transcript variant B (CG31291), mRNA 
0   NM_169683.1  CG31291-RA, transcript variant A (CG31291), mRNA 
0   12  11  NM_136992.2  CG13325-RA (CG13325), mRNA 
0   NM_136741.2  CG11763-RC, transcript variant C (micr), mRNA 
0   NM_165770.1  CG11763-RA, transcript variant A (micr), mRNA 
0   NM_001038849.1  CG11763-RD, transcript variant D (micr), mRNA 
0   NM_206013.2  CG33321-RA (CheB38b), mRNA 
0   NM_164401.3  CG31795-RB, transcript variant B (ia2), mRNA 
0   NM_134718.4  CG31795-RA, transcript variant A (ia2), mRNA 
0   NM_130670.1  CG2709-RA (CG2709), mRNA 
0   NM_132457.1  CG11122-RA (CG11122), mRNA 
0   NM_135394.2  CG13089-RA (CG13089), mRNA 
0   NM_001038882.1  CG4622-RB, transcript variant B (CG4622), mRNA 
0   NM_138086.2  CG11413-RA (CG11413), mRNA 
0   NM_132267.4  CG12109-RB (Caf1-180), mRNA 
0   NM_143176.2  CG14354-RA (CG14354), mRNA 
0   NM_079111.2  CG2827-RA (Tal), mRNA 
0   NM_167312.1  CG10353-RB, transcript variant B (CG10353), mRNA 
0   NM_165693.2  CG30004-RA (CG30004), mRNA 
0   11  NM_206546.1  CG33337-RA (CG33337), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.