National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5139Ra-1 
 Symbol CG5139  Full Name CG5139 
 CG No CG5139  Old CG No CG5139 
 Synonyms CG5139 
 Accession No (Link to NCBI) NM_134743.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGAATACGCTGCAGGAAGTCG 
 Primer Seq. 3'
aatctagaggtaccTGAGCAGCAGCAGTGGTAACA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGAATACGCT GCAGGAAGTC GAGCAAGTCG AGGTTGCTTT TAAGCAGACC TTGAGAAACA 
0061 TTACCGATAT CCAGAACCGA TACAAAACGG TTTCGGCCTT GAAGAGCAAG GCCTNCAAGC 
0121 GCCAGGAATC CTTCGAGGCG GAGATCCAAG GTGCCATTAC AGCACCCAAT CCTGCCAAGA 
0181 AAAGGAGGGT GGTCAAGAAG AGCAAGATCA ATATGGGAAN GAAGAGACNG NTCATAAAGA 
0241 ACAAGGTGAT TGTCCGGACG AAACAGAGGA GTCTGCTACC AATGCCAGTA CCCAATCTCA 
0301 GATCGGAAAC TATCCTGCAG GTGGAGGAGC CTTTTGTGTG TCTCGAAACG AATTGCGTCT 
0361 ACGAAATACA CAAGACAACC ACTCACCTGA TGGCGCGGAA ACCATATGGA GCTCTCATCC 
0421 GGCGACTGTA TCGGTCAGCC AGGCGGAAGA GGATGTACGA CCAGGAGCAG GAACAGGATC 
0481 AGGAACAGGA TGAGGAACAG GATCTGTATC CAGACATGGA ATGTTACCAC TGCTGCTGCT 
0541 CA 
 in silico PCR Fragment
0001 GGAATACGCT GCAGGAAGTC GAGCAAGTCG AGGTTGCTTT TAAGCAGACC TTGAGAAACA 
0061 TTACCGATAT CCAGAACCGA TACAAAACGG TTTCGGCCTT GAAGAGCAAG GCCTCCAGGC 
0121 GCCAGGAATC CTTCGAGGCG GAGATCCAAG GTGCCATTAC AGCACCCAAT CCTGCCAAGA 
0181 AAAGGAGGGT GGTCAAGAAG AGCAAGATCA ATATCTTGAA ACAGAGGAGT CTGCTACCAA 
0241 TGCCAGTACC CAATCTCAGA TCGGAAACTA TCCTGCAGGT GGAGGAGCCT TTTGTGTGTC 
0301 TCGAAACGAA TTGCGTCTAC GAAATACACA AGACAACCAC TCACCTGATG GCGCGGAAAC 
0361 CATATGGAGC TCTCATCCGG CGACTGTATC GGTCAGCCAG GCGGAAGAGG ATGTACGACC 
0421 AGGAGCAGGA ACAGGATCAG GAACAGGTTG AGGAACAGGA TCTGTATCCA GACATGGAAT 
0481 GTTACCACTG CTGCTGCTCA  
 Assemble Data

5139Ra-1.IR full       1   GGAATACGCTGCAGGAAGTCGAGCAAGTCGAGGTTGCTTTTAAGCAGACCTTGAGAAACA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5139Ra-1.in silico     1   GGAATACGCTGCAGGAAGTCGAGCAAGTCGAGGTTGCTTTTAAGCAGACCTTGAGAAACA 60


5139Ra-1.IR full       61  TTACCGATATCCAGAACCGATACAAAACGGTTTCGGCCTTGAAGAGCAAGGCCTNCAAGC 120
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||
5139Ra-1.in silico     61  TTACCGATATCCAGAACCGATACAAAACGGTTTCGGCCTTGAAGAGCAAGGCCTCCAGGC 120


5139Ra-1.IR full       121 GCCAGGAATCCTTCGAGGCGGAGATCCAAGGTGCCATTACAGCACCCAATCCTGCCAAGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5139Ra-1.in silico     121 GCCAGGAATCCTTCGAGGCGGAGATCCAAGGTGCCATTACAGCACCCAATCCTGCCAAGA 180


5139Ra-1.IR full       181 AAAGGAGGGTGGTCAAGAAGAGCAAGATCAATATGGGAANGAAGAGACNGNTCATAAAGA 240
                           ||||||||||||||||||||||||||||||||||                 |        
5139Ra-1.in silico     181 AAAGGAGGGTGGTCAAGAAGAGCAAGATCAATAT----------------CTT------- 240


5139Ra-1.IR full       241 ACAAGGTGATTGTCCGGACGAAACAGAGGAGTCTGCTACCAATGCCAGTACCCAATCTCA 300
                                              |||||||||||||||||||||||||||||||||||||||||
5139Ra-1.in silico     241 -------------------GAAACAGAGGAGTCTGCTACCAATGCCAGTACCCAATCTCA 300


5139Ra-1.IR full       301 GATCGGAAACTATCCTGCAGGTGGAGGAGCCTTTTGTGTGTCTCGAAACGAATTGCGTCT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5139Ra-1.in silico     301 GATCGGAAACTATCCTGCAGGTGGAGGAGCCTTTTGTGTGTCTCGAAACGAATTGCGTCT 360


5139Ra-1.IR full       361 ACGAAATACACAAGACAACCACTCACCTGATGGCGCGGAAACCATATGGAGCTCTCATCC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5139Ra-1.in silico     361 ACGAAATACACAAGACAACCACTCACCTGATGGCGCGGAAACCATATGGAGCTCTCATCC 420


5139Ra-1.IR full       421 GGCGACTGTATCGGTCAGCCAGGCGGAAGAGGATGTACGACCAGGAGCAGGAACAGGATC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5139Ra-1.in silico     421 GGCGACTGTATCGGTCAGCCAGGCGGAAGAGGATGTACGACCAGGAGCAGGAACAGGATC 480


5139Ra-1.IR full       481 AGGAACAGGATGAGGAACAGGATCTGTATCCAGACATGGAATGTTACCACTGCTGCTGCT 540
                           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
5139Ra-1.in silico     481 AGGAACAGGTTGAGGAACAGGATCTGTATCCAGACATGGAATGTTACCACTGCTGCTGCT 540


5139Ra-1.IR full       541 CA 542
                           ||
5139Ra-1.in silico     541 CA 542

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  10  38  NM_134743.1  CG5139-RA (CG5139), mRNA 
0.41   18  NM_079508.2  CG2534-RA, transcript variant A (cno), mRNA 
0.41   18  NM_169025.1  CG2534-RB, transcript variant B (cno), mRNA 
0   11  29  32  NM_079002.2  CG3905-RA (Su(z)2), mRNA 
0   10  16  NM_133138.1  CG7884-RA (CG7884), mRNA 
0   22  54  NM_130688.2  CG14423-RA (CG14423), mRNA 
0   16  29  NM_135753.2  CG9934-RA (CG9934), mRNA 
0   44  71  NM_132841.1  CG8260-RA, transcript variant A (CG8260), mRNA 
0   44  71  NM_206723.1  CG8260-RB, transcript variant B (CG8260), mRNA 
0   28  65  NM_133159.1  CG14200-RA (CG14200), mRNA 
0   24  49  NM_079994.3  CG12630-RA (tio), mRNA 
0   11  NM_130498.1  CG13362-RA (CG13362), mRNA 
0   15  NM_078974.2  CG7776-RA, transcript variant A (E(Pc)), mRNA 
0   15  NM_165836.1  CG7776-RB, transcript variant B (E(Pc)), mRNA 
0   NM_165609.1  CG30361-RB, transcript variant B (mXr), mRNA 
0   13  18  NM_167487.1  CG32577-RA (disco-r), mRNA 
0   11  27  NM_140112.1  CG14165-RA (CG14165), mRNA 
0   10  21  NM_144453.2  CG13061-RA (Nplp3), mRNA 
0   16  NM_001042802.1  CG34104-RA, transcript variant A (CG34104), mRNA 
0   16  NM_001042801.1  CG34104-RB, transcript variant B (CG34104), mRNA 
0   17  NM_139541.1  CG12017-RA (CG12017), mRNA 
0   12  NM_078748.2  CG12205-RA (Bsg25A), mRNA 
0   12  NM_143712.2  CG1404-RA, transcript variant A (ran), mRNA 
0   16  NM_144011.1  CG14063-RA (CG14063), mRNA 
0   NM_165207.1  CG31748-RA (Gr36c), mRNA 
0   NM_167242.1  CG32675-RA, transcript variant A (Tango5), mRNA 
0   NM_167244.1  CG32675-RB, transcript variant B (Tango5), mRNA 
0   NM_142039.1  CG9759-RA, transcript variant A (CG9759), mRNA 
0   NM_169527.1  CG9759-RB, transcript variant B (CG9759), mRNA 
0   NM_167243.1  CG32675-RC, transcript variant C (Tango5), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.