National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5137R-2 
 Symbol Cyp312a1  Full Name Cyp312a1 
 CG No CG5137  Old CG No CG5137 
 Synonyms 312a1, CG5137, Cyp312a1 
 Accession No (Link to NCBI) NM_140773.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGCTGGGATTCGGATTGCTG 
 Primer Seq. 3'
aatctagaggtaccTCCCCGGACTCGGCAAATTTA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGGCTGGGAT TCGGATTGCT GTTGCTCGCG TTGTCCCTAT ACCTGCTATA TGTCTTCGAG 
0061 CGGCAGAGCA GGATCGACCG GCTCACCCAC AAATGGCCAN GCCCCACCGG CCCTGCCATT 
0121 CATTGGCCAT CTGCACATTC TAGCCAAATT GGTGGGACCG CATCCACTTC GACGAGCCAC 
0181 CGAAATGATC AACGAACATC TGCACGATCA TCGAGCAAAA CTATGGATGG GCACTAAGCT 
0241 CTATCTCGTG GACTGCAATC CCAAGGATAT ACAGGCTCTG TGCAGTGCCC AGCAGCTGCT 
0301 GCAGAAGACC AACGACTATA GGGTCTTCGA GAACTGGCTC TGCGAGGGTC TCTTCACCAG 
0361 TGGATTCGAG AAGTGGTCCC ATCGCCGGAA GATCGTAATG CCGGCCTTCA ACTACACCAT 
0421 GATCAAACAG TTTGTTGCCG TCTTTGAGAA GCAGTCGAGG ATTCTTTTGA CGAATGTCGC 
0481 TAAATTTGCC GAGTCCGGGG A 
 in silico PCR Fragment
0001 TGGCTGGGAT TCGGATTGCT GTTGCTCGCG TTGTCCCTAT ACCTGCTATA TGTCTTCGAG 
0061 CGGCAGAGCA GGATCGACCG GCTCACCCAC AAATGGCCA- GCCCCACCGG CCCTGCCATT 
0121 CATTGGCCAT CTGCACATTC TAGCCAAATT GGTGGGACCG CATCCACTTC GACGAGCCAC 
0181 CGAAATGATC AACGAACATC TACACGATCA TCGAGCAAAA CTATGGATGG GCACTAAGCT 
0241 CTATCTCGTG GACTGCAATC CCAAGGATAT ACAGGCTCTG TGCAGTGCCC AGCAGCTGCT 
0301 GCAGAAGACC AACGACTATA GGGTCTTCGA GAACTGGCTC TGCGAGGGTC TCTTCACCAG 
0361 TGGATTCGAG AAGTGGTCCC ATCGCCGGAA GATCGTAATG CCGGCCTTCA ACTACACCAT 
0421 GATCAAACAG TTTGTTGCCG TCTTTGAGAA GCAGTCGAGG ATTCTTTTGA CGAATGTCGC 
0481 TAAATTTGCC GAGTCCGGGG A 
 Assemble Data

5137R-2.IR_full       1   TGGCTGGGATTCGGATTGCTGTTGCTCGCGTTGTCCCTATACCTGCTATATGTCTTCGAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5137R-2.in silico     1   TGGCTGGGATTCGGATTGCTGTTGCTCGCGTTGTCCCTATACCTGCTATATGTCTTCGAG 60


5137R-2.IR_full       61  CGGCAGAGCAGGATCGACCGGCTCACCCACAAATGGCCANGCCCCACCGGCCCTGCCATT 120
                          ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
5137R-2.in silico     61  CGGCAGAGCAGGATCGACCGGCTCACCCACAAATGGCCA-GCCCCACCGGCCCTGCCATT 120


5137R-2.IR_full       121 CATTGGCCATCTGCACATTCTAGCCAAATTGGTGGGACCGCATCCACTTCGACGAGCCAC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5137R-2.in silico     121 CATTGGCCATCTGCACATTCTAGCCAAATTGGTGGGACCGCATCCACTTCGACGAGCCAC 180


5137R-2.IR_full       181 CGAAATGATCAACGAACATCTGCACGATCATCGAGCAAAACTATGGATGGGCACTAAGCT 240
                          ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
5137R-2.in silico     181 CGAAATGATCAACGAACATCTACACGATCATCGAGCAAAACTATGGATGGGCACTAAGCT 240


5137R-2.IR_full       241 CTATCTCGTGGACTGCAATCCCAAGGATATACAGGCTCTGTGCAGTGCCCAGCAGCTGCT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5137R-2.in silico     241 CTATCTCGTGGACTGCAATCCCAAGGATATACAGGCTCTGTGCAGTGCCCAGCAGCTGCT 300


5137R-2.IR_full       301 GCAGAAGACCAACGACTATAGGGTCTTCGAGAACTGGCTCTGCGAGGGTCTCTTCACCAG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5137R-2.in silico     301 GCAGAAGACCAACGACTATAGGGTCTTCGAGAACTGGCTCTGCGAGGGTCTCTTCACCAG 360


5137R-2.IR_full       361 TGGATTCGAGAAGTGGTCCCATCGCCGGAAGATCGTAATGCCGGCCTTCAACTACACCAT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5137R-2.in silico     361 TGGATTCGAGAAGTGGTCCCATCGCCGGAAGATCGTAATGCCGGCCTTCAACTACACCAT 420


5137R-2.IR_full       421 GATCAAACAGTTTGTTGCCGTCTTTGAGAAGCAGTCGAGGATTCTTTTGACGAATGTCGC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5137R-2.in silico     421 GATCAAACAGTTTGTTGCCGTCTTTGAGAAGCAGTCGAGGATTCTTTTGACGAATGTCGC 480


5137R-2.IR_full       481 TAAATTTGCCGAGTCCGGGGA 501
                          |||||||||||||||||||||
5137R-2.in silico     481 TAAATTTGCCGAGTCCGGGGA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140773.1  CG5137-RA (Cyp312a1), mRNA 
0   11  NM_001042904.1  CG15148-RB, transcript variant B (btv), mRNA 
0   11  NM_001042905.1  CG15148-RC, transcript variant C (btv), mRNA 
0   11  NM_136013.1  CG15148-RA, transcript variant A (btv), mRNA 
0   NM_169197.2  CG31187-RA (CG31187), mRNA 
0   NM_176177.1  CG33139-RA (Ranbp11), mRNA 
0   NM_143476.2  CG7802-RA, transcript variant A (CG7802), mRNA 
0   NM_206583.1  CG7802-RB, transcript variant B (CG7802), mRNA 
0   NM_206760.1  CG9214-RB, transcript variant B (Tob), mRNA 
0   NM_132876.3  CG9214-RA, transcript variant A (Tob), mRNA 
0   NM_140629.1  CG16807-RA (CG16807), mRNA 
0   NM_057658.4  CG12019-RA (Cdc37), mRNA 
0   NM_134750.1  CG5440-RA (CG5440), mRNA 
0   NM_137920.1  CG9899-RA (CG9899), mRNA 
0   NM_079939.2  CG5580-RA, transcript variant A (sbb), mRNA 
0   NM_142601.1  CG4845-RA (CG4845), mRNA 
0   NM_079392.2  CG4086-RA (Su(P)), mRNA 
0   NM_143336.1  CG5003-RA (CG5003), mRNA 
0   NM_001014668.1  CG8318-RD, transcript variant D (Nf1), mRNA 
0   NM_170252.2  CG8318-RC, transcript variant C (Nf1), mRNA 
0   NM_170253.2  CG8318-RB, transcript variant B (Nf1), mRNA 
0   NM_206610.1  CG14047-RB, transcript variant B (CG14047), mRNA 
0   NM_078875.2  CG10446-RA (Side), mRNA 
0   NM_130645.2  CG14047-RA, transcript variant A (CG14047), mRNA 
0   NM_079384.2  CG4314-RA (st), mRNA 
0   18  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   16  NM_001032053.1  CG33715-RB, transcript variant B (Msp-300), mRNA 
0   NM_001038969.1  CG12753-RB, transcript variant B (CG12753), mRNA 
0   NM_142285.1  CG12753-RA, transcript variant A (CG12753), mRNA 
0   NM_132323.1  CG17438-RA (CG17438), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.