National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5126R-4 
 Symbol CG5126  Full Name CG5126 
 CG No CG5126  Old CG No CG5126 
 Synonyms CG5126 
 Accession No (Link to NCBI) NM_134740.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGAGCGCCACCTGGTGTACGA 
 Primer Seq. 3'
aatctagaggtaccAGCCCAGAGCATGGAACGGAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGAGCGCCAC CTGGTGTACG ACATCTTCAA GAACTTTGGT CCGAGTGCTT CGCTGGAATC 
0061 GCACAGCGTT GAGTGCTCCA ATGGACTGGA CGGCTTCATG TCCGCCTTGT ACACCGTTAC 
0121 GCTGGACGTG GTCATCGCCG AGCGCAAGCG GACGGAGGTC GTCCTGGTCA AATTCATGAA 
0181 GGGAACGGAA GAGTTCCGGG AGAGCAGCAA CTCGTACATC CAGTTTTCCA ACGAGATCTT 
0241 CGCCTACGCC GAGATCCTGC CCGCCTATGA GAATGTGCTT CGGACGAGTC ACCTGGAAAG 
0301 CGAAGTGGTA AAGAACTGGG TTCCCTGTTG CTACTTCGCC AGGTTTGGCC ACGTTGAAGG 
0361 TTTAGGGAAT GGTAGGGAAT CGGTGCTGGC CCTAAAGCAT CTCAAGGGCG ATGGCTACCA 
0421 ATTgGGGCCA AGGCTAACCC TTCGACGGGA TCAGCTGGAG GCCATGGTAG GACTAGTGGG 
0481 TCCGTTCCAT GCTCTGGGCT  
 in silico PCR Fragment
0001 AGAGCGCCAC CTGGTGTACG ACATCTTCAA GAACTTTGGT CCGAGTGCTT CGCTGGAATC 
0061 GCACAGCGTT GAGTGCTCCA ATGGACTGGA CGGCTTCATG TCCGCCTTGT ACACCGTTAC 
0121 GCTGGACGTG GTCATCGCCG AGCGCAAGCG GACGGAGGTC GTCCTGGTCA AATTCATGAA 
0181 GGGAACGGAA GAGTTCCGGG AGAGCAGCAA CTCGTACATC CAGTTTTCCA ACGAGATCTT 
0241 CGCCTACGCC GAGATCCTGC CCGCCTATGA GAATGTGCTT CGGACGAGTC ACCTGGAAAG 
0301 CGAAGTGGTA AAGAACTGGG TTCCCTGTTG CTACTTCGCC AGGTTTGGCC ACGTTGAAGG 
0361 TTTAGGGAAT GGTAGGGAAT CGGTGCTGGC CCTAAAGCAT CTCAAGGGCG ATGGCTACCA 
0421 ATTGGGGCCA AGGCTAACCC TTCGACGGGA TCAGCTGGAG GCCATGGTAG GACTAGTGGG 
0481 TCCGTTCCAT GCTCTGGGCT  
 Assemble Data

5126R-4.IR_full       1   AGAGCGCCACCTGGTGTACGACATCTTCAAGAACTTTGGTCCGAGTGCTTCGCTGGAATC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5126R-4.in silico     1   AGAGCGCCACCTGGTGTACGACATCTTCAAGAACTTTGGTCCGAGTGCTTCGCTGGAATC 60


5126R-4.IR_full       61  GCACAGCGTTGAGTGCTCCAATGGACTGGACGGCTTCATGTCCGCCTTGTACACCGTTAC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5126R-4.in silico     61  GCACAGCGTTGAGTGCTCCAATGGACTGGACGGCTTCATGTCCGCCTTGTACACCGTTAC 120


5126R-4.IR_full       121 GCTGGACGTGGTCATCGCCGAGCGCAAGCGGACGGAGGTCGTCCTGGTCAAATTCATGAA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5126R-4.in silico     121 GCTGGACGTGGTCATCGCCGAGCGCAAGCGGACGGAGGTCGTCCTGGTCAAATTCATGAA 180


5126R-4.IR_full       181 GGGAACGGAAGAGTTCCGGGAGAGCAGCAACTCGTACATCCAGTTTTCCAACGAGATCTT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5126R-4.in silico     181 GGGAACGGAAGAGTTCCGGGAGAGCAGCAACTCGTACATCCAGTTTTCCAACGAGATCTT 240


5126R-4.IR_full       241 CGCCTACGCCGAGATCCTGCCCGCCTATGAGAATGTGCTTCGGACGAGTCACCTGGAAAG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5126R-4.in silico     241 CGCCTACGCCGAGATCCTGCCCGCCTATGAGAATGTGCTTCGGACGAGTCACCTGGAAAG 300


5126R-4.IR_full       301 CGAAGTGGTAAAGAACTGGGTTCCCTGTTGCTACTTCGCCAGGTTTGGCCACGTTGAAGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5126R-4.in silico     301 CGAAGTGGTAAAGAACTGGGTTCCCTGTTGCTACTTCGCCAGGTTTGGCCACGTTGAAGG 360


5126R-4.IR_full       361 TTTAGGGAATGGTAGGGAATCGGTGCTGGCCCTAAAGCATCTCAAGGGCGATGGCTACCA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5126R-4.in silico     361 TTTAGGGAATGGTAGGGAATCGGTGCTGGCCCTAAAGCATCTCAAGGGCGATGGCTACCA 420


5126R-4.IR_full       421 ATTGGGGCCAAGGCTAACCCTTCGACGGGATCAGCTGGAGGCCATGGTAGGACTAGTGGG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5126R-4.in silico     421 ATTGGGGCCAAGGCTAACCCTTCGACGGGATCAGCTGGAGGCCATGGTAGGACTAGTGGG 480


5126R-4.IR_full       481 TCCGTTCCATGCTCTGGGCT 500
                          ||||||||||||||||||||
5126R-4.in silico     481 TCCGTTCCATGCTCTGGGCT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134740.2  CG5126-RA (CG5126), mRNA 
0   NM_141402.1  CG15186-RA, transcript variant A (CG15186), mRNA 
0   NM_206436.1  CG15186-RC, transcript variant C (CG15186), mRNA 
0   NM_169145.1  CG15186-RB, transcript variant B (CG15186), mRNA 
0   NM_136989.1  CG13324-RA (CG13324), mRNA 
0   NM_135781.2  CG5867-RA (CG5867), mRNA 
0   NM_080047.2  CG8491-RA (kto), mRNA 
0   NM_132634.2  CG12096-RA (CG12096), mRNA 
0   NM_078937.3  CG2411-RA (ptc), mRNA 
0   NM_164717.1  CG10806-RA, transcript variant A (CG10806), mRNA 
0   NM_135236.2  CG10806-RB, transcript variant B (CG10806), mRNA 
0   NM_133059.2  CG6106-RA (CG6106), mRNA 
0   NM_132681.1  CG15760-RA (CG15760), mRNA 
0   NM_137528.3  CG15078-RA, transcript variant A (Mctp), mRNA 
0   NM_001043094.1  CG15078-RC, transcript variant C (Mctp), mRNA 
0   NM_142520.2  CG6013-RA (CG6013), mRNA 
0   NM_079641.2  CG4938-RA (Aats-ser), mRNA 
0   NM_168087.1  CG32241-RA (CG32241), mRNA 
0   NM_140200.1  CG6175-RB (CG6175), mRNA 
0   20  NM_134517.2  CG15618-RA (CG15618), mRNA 
0   12  NM_165396.1  CG31619-RA, transcript variant A (CG31619), mRNA 
0   12  NM_001042909.1  CG31619-RC, transcript variant C (CG31619), mRNA 
0   NM_139492.2  CG2103-RA, transcript variant A (pgant6), mRNA 
0   NM_167966.1  CG2103-RB, transcript variant B (pgant6), mRNA 
0   NM_141021.1  CG10584-RA (CG10584), mRNA 
0   12  NM_139680.1  CG17150-RA, transcript variant A (CG17150), mRNA 
0   10  NM_078696.2  CG1467-RA (Syx16), mRNA 
0   NM_001043268.1  CG31201-RB (GluRIIE), mRNA 
0   NM_139371.1  CG13917-RA (CG13917), mRNA 
0   NM_079818.2  CG10002-RA (fkh), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.