National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5126R-1 
 Symbol CG5126  Full Name CG5126 
 CG No CG5126  Old CG No CG5126 
 Synonyms CG5126 
 Accession No (Link to NCBI) NM_134740.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AGAGCGCCACCTGGTGTACGACATCTTCAAGAACTTTGGTCCGAGTGCTTCGCTGGAATC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCACAGCGTTGAGTGCTCCAATGGACTGGACGGCTTCATGTCCGCCTTGTACACCGTTAC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GCTGGACGTGGTCATCGCCGAGCGCAAGCGGACGGAGGTCGTCCTGGTCAAATTCATGAA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GGGAACGGAAGAGTTCCGGGAGAGCAGCAACTCGTACATCCAGTTTTCCAACGAGATCTT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CGCCTACGCCGAGATCCTGCCCGCCTATGAGAATGTGCTTCGGACGAGTCACCTGGAAAG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CGAAGTGGTAAAGAACTGGGTTCCCTGTTGCTACTTCGCCAGGTTTGGCCACGTTGAAGG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TTTAGGGAATGGTAGGGAATCGGTGCTGGCCCTAAAGCATCTCAAGGGCGATGGCTACCA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ATTGGGGCCAAGGCTAACCCTTCGACGGGATCAGCTGGAGGCCATGGTAGGACTAGTGGG 480

5126R-1.IR_full       481 TCCGTTCCATGCTCTGGGCT 500
                          |||||||||||||||||||| silico     481 TCCGTTCCATGCTCTGGGCT 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134740.2  CG5126-RA (CG5126), mRNA 
0   NM_141402.1  CG15186-RA, transcript variant A (CG15186), mRNA 
0   NM_206436.1  CG15186-RC, transcript variant C (CG15186), mRNA 
0   NM_169145.1  CG15186-RB, transcript variant B (CG15186), mRNA 
0   NM_136989.1  CG13324-RA (CG13324), mRNA 
0   NM_135781.2  CG5867-RA (CG5867), mRNA 
0   NM_080047.2  CG8491-RA (kto), mRNA 
0   NM_132634.2  CG12096-RA (CG12096), mRNA 
0   NM_078937.3  CG2411-RA (ptc), mRNA 
0   NM_164717.1  CG10806-RA, transcript variant A (CG10806), mRNA 
0   NM_135236.2  CG10806-RB, transcript variant B (CG10806), mRNA 
0   NM_133059.2  CG6106-RA (CG6106), mRNA 
0   NM_132681.1  CG15760-RA (CG15760), mRNA 
0   NM_137528.3  CG15078-RA, transcript variant A (Mctp), mRNA 
0   NM_001043094.1  CG15078-RC, transcript variant C (Mctp), mRNA 
0   NM_142520.2  CG6013-RA (CG6013), mRNA 
0   NM_079641.2  CG4938-RA (Aats-ser), mRNA 
0   NM_168087.1  CG32241-RA (CG32241), mRNA 
0   NM_140200.1  CG6175-RB (CG6175), mRNA 
0   20  NM_134517.2  CG15618-RA (CG15618), mRNA 
0   12  NM_165396.1  CG31619-RA, transcript variant A (CG31619), mRNA 
0   12  NM_001042909.1  CG31619-RC, transcript variant C (CG31619), mRNA 
0   NM_139492.2  CG2103-RA, transcript variant A (pgant6), mRNA 
0   NM_167966.1  CG2103-RB, transcript variant B (pgant6), mRNA 
0   NM_141021.1  CG10584-RA (CG10584), mRNA 
0   12  NM_139680.1  CG17150-RA, transcript variant A (CG17150), mRNA 
0   10  NM_078696.2  CG1467-RA (Syx16), mRNA 
0   NM_001043268.1  CG31201-RB (GluRIIE), mRNA 
0   NM_139371.1  CG13917-RA (CG13917), mRNA 
0   NM_079818.2  CG10002-RA (fkh), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.