National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5118R-3 
 Symbol CG5118  Full Name CG5118 
 CG No CG5118  Old CG No CG5118 
 Synonyms anon-WO0140519.11, CG5118 
 Accession No (Link to NCBI) NM_134737.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCCATCTCAGCGCCACATAGT 
 Primer Seq. 3'
aatctagaggtaccGCTTGGGTGACATCCCTTTTC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCCATCTCAG CGCCACATAG TGCCTCTACC TACATCCAGC GCAAGTCCTT CCAGCCCGTC 
0061 TACGAGGACA TCTTCAAATT ACTCCTGAAA ATCCCAGACA AAGCCCTTAC CCAAAGGGTG 
0121 ATCGACGCGA TAAACGAGAG CAATAATAAC GATAAGGTCG CTATCTCCAA TCACGGTAAA 
0181 CAATGTTCGT GCGGAGTCCA AAAAGTCGAT TCATCTACAC AAACGGATTG GGACACCGAG 
0241 GAAACGCATA AGCCTGGCAT TACAAATAAT TCATGCGAAG CCGAAGGGAA TAGGCATAGC 
0301 CACATGACCA GTTCAAGTTC CGAACCTATA AAACCGCCAG TAGATCCGAC CAAAGTTCCT 
0361 AAAAAGCGCG GTAGAAAGCG AAACACCTGC GTGCCACAGG TGGTCAAGCG ATCAGCGGCT 
0421 GAGATGGCGC TTAAGGAGCG CGAGGAGAAG CAACTGACGC CCGTGATCAC TAAACGGAAG 
0481 AAAAGGGATG TCACCCAAGC  
 in silico PCR Fragment
0001 TCCATCTCAG CGCCACATAG TGCCTCTACC TACATCCAGC GCAAGTCCTT CCAGCCCGTC 
0061 TACGAGGACA TCTTCAAATT ACTCATGAAA ATCCCAGACA AAGCCCTTAC CCAAAGGGTG 
0121 ATCGACGCGA TAAACGAGAG CAATAATAAC GATAAGGTCG CTATCTCCAA TCACGGTAAA 
0181 CAATGTTCGT GCGGAGTCCA AAAAGTCGAT TCATCTACAC AAACGGATTG GGACACCGAG 
0241 GAAACGCATA TGCCTGGCAT TACAAATAAT TCATGCGAAG CCAAAGGGAA TAGGCATAGC 
0301 CACATGACCA GTTCAAGTTC CGAACCTATA AAACCGCCAG TAGATCCGAC CAAAGTTCCT 
0361 AAAAAGCGCG GTAGAAAGCG AAACACCTGC GTGCCACAGG TGGTCAAGCG ATCAGCGGCT 
0421 GAGATGGCGC TTAAGGAGCG CGAGGAGAAG CAACTGACGC CCGTGATCAC TAAACGGAAG 
0481 AAAAGGGATG TCACCCAAGC  
 Assemble Data

5118R-3.IR_full       1   TCCATCTCAGCGCCACATAGTGCCTCTACCTACATCCAGCGCAAGTCCTTCCAGCCCGTC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5118R-3.in silico     1   TCCATCTCAGCGCCACATAGTGCCTCTACCTACATCCAGCGCAAGTCCTTCCAGCCCGTC 60


5118R-3.IR_full       61  TACGAGGACATCTTCAAATTACTCCTGAAAATCCCAGACAAAGCCCTTACCCAAAGGGTG 120
                          |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
5118R-3.in silico     61  TACGAGGACATCTTCAAATTACTCATGAAAATCCCAGACAAAGCCCTTACCCAAAGGGTG 120


5118R-3.IR_full       121 ATCGACGCGATAAACGAGAGCAATAATAACGATAAGGTCGCTATCTCCAATCACGGTAAA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5118R-3.in silico     121 ATCGACGCGATAAACGAGAGCAATAATAACGATAAGGTCGCTATCTCCAATCACGGTAAA 180


5118R-3.IR_full       181 CAATGTTCGTGCGGAGTCCAAAAAGTCGATTCATCTACACAAACGGATTGGGACACCGAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5118R-3.in silico     181 CAATGTTCGTGCGGAGTCCAAAAAGTCGATTCATCTACACAAACGGATTGGGACACCGAG 240


5118R-3.IR_full       241 GAAACGCATAAGCCTGGCATTACAAATAATTCATGCGAAGCCGAAGGGAATAGGCATAGC 300
                          |||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||
5118R-3.in silico     241 GAAACGCATATGCCTGGCATTACAAATAATTCATGCGAAGCCAAAGGGAATAGGCATAGC 300


5118R-3.IR_full       301 CACATGACCAGTTCAAGTTCCGAACCTATAAAACCGCCAGTAGATCCGACCAAAGTTCCT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5118R-3.in silico     301 CACATGACCAGTTCAAGTTCCGAACCTATAAAACCGCCAGTAGATCCGACCAAAGTTCCT 360


5118R-3.IR_full       361 AAAAAGCGCGGTAGAAAGCGAAACACCTGCGTGCCACAGGTGGTCAAGCGATCAGCGGCT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5118R-3.in silico     361 AAAAAGCGCGGTAGAAAGCGAAACACCTGCGTGCCACAGGTGGTCAAGCGATCAGCGGCT 420


5118R-3.IR_full       421 GAGATGGCGCTTAAGGAGCGCGAGGAGAAGCAACTGACGCCCGTGATCACTAAACGGAAG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5118R-3.in silico     421 GAGATGGCGCTTAAGGAGCGCGAGGAGAAGCAACTGACGCCCGTGATCACTAAACGGAAG 480


5118R-3.IR_full       481 AAAAGGGATGTCACCCAAGC 500
                          ||||||||||||||||||||
5118R-3.in silico     481 AAAAGGGATGTCACCCAAGC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134737.2  CG5118-RA (CG5118), mRNA 
0   NM_143142.2  CG5116-RA (CG5116), mRNA 
0   NM_176739.1  CG33173-RA (CG33173), mRNA 
0   NM_176370.1  CG16993-RA (in), mRNA 
0   NM_136733.2  CG12907-RA (CG12907), mRNA 
0   NM_168808.1  CG8756-RC, transcript variant C (LCBP1), mRNA 
0   NM_168810.1  CG8756-RB, transcript variant B (LCBP1), mRNA 
0   NM_168809.1  CG8756-RA, transcript variant A (LCBP1), mRNA 
0   NM_140885.1  CG8756-RD, transcript variant D (LCBP1), mRNA 
0   NM_139780.2  CG13298-RA (CG13298), mRNA 
0   NM_137789.2  CG11475-RA (CG11475), mRNA 
0   NM_132981.1  CG8675-RA (CG8675), mRNA 
0   NM_140295.2  CG6811-RA (RhoGAP68F), mRNA 
0   NM_206463.1  CG8379-RB, transcript variant B (CG8379), mRNA 
0   NM_141584.3  CG8379-RA, transcript variant A (CG8379), mRNA 
0   NM_132014.2  CG4119-RA (CG4119), mRNA 
0   NM_079861.2  CG1455-RA (CanA1), mRNA 
0   NM_136553.2  CG8639-RA (Cirl), mRNA 
0   NM_165219.1  CG6667-RC, transcript variant C (dl), mRNA 
0   NM_165218.1  CG6667-RB, transcript variant B (dl), mRNA 
0   NM_165217.1  CG6667-RA, transcript variant A (dl), mRNA 
0   NM_137491.2  CG5190-RA (CG5190), mRNA 
0   NM_143045.2  CG13641-RA (CG13641), mRNA 
0   NM_142520.2  CG6013-RA (CG6013), mRNA 
0   NM_136172.2  CG10680-RA (CG10680), mRNA 
0   NM_140344.1  CG10967-RA (Atg1), mRNA 
0   NM_140284.1  CG6793-RA (CG6793), mRNA 
0   NM_135156.2  CG13991-RA (CG13991), mRNA 
0   NM_136185.2  CG10651-RA (CG10651), mRNA 
0   NM_165153.1  CG31817-RA (CG31817), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.