National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5109R-1 
 Symbol Pcl  Full Name Polycomblike 
 CG No CG5109  Old CG No CG5109 
 Synonyms CG5109, PCL, pcl, l(2)s1859, Pcl 
 Accession No (Link to NCBI) NM_057324.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Savla U, Benes J, Zhang J, Jones RS.
Recruitment of Drosophila Polycomb-group proteins by Polycomblike, a component of a novel protein complex in larvae.
Development (2008) 135(5) 813-7 [ PubMed ID = 18216170 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGACCACCTACCAGATCCTGC 
 Primer Seq. 3'
aatctagaggtaccTTGTTGGGCCGTGGTAAGCGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CNACCACCTA CCAGATCCTG CCGCCCAGCG TAGGACCTGC CACGGTGGCC AAGCGATACT 
0061 ATGCCACCAC TGGGCCGCAG ACCACGCATC CCACACATCC CAGCACCATC CAGATCACGA 
0121 ACAGTTTCGC TCAGCAATCA ACGCCACCGA AGCAACAGGC GGCAACANAG CTGCAGCCCA 
0181 TTCAAGGCCA ACAACATACG AATCATCTCG ACGGCGCCAA GTGTATACAG TCTGAATAAG 
0241 CCGCCACAGG AAGCGCACTC CACATATGCT CCCGTTCAGT CGTACTACTT GCCCAGTGGC 
0301 GGTGGCCAAA CTGCGGGACA AATCAATCTA CTGGCGGCCA GCGGAACTGG CAAGCANACT 
0361 GCAGCCGCCG CCGCTGGTGC CTGTGACCAA TTCCACCTCA CCGCCCTCCA CCGTCGTGTT 
0421 AGACCGCATA AACATTTGCA TCAATAACCA CTATACGGAG ACGCCCACTT CGCTAAGTTC 
0481 ATCGCTTACC ACGGCCCAAC AA 
 in silico PCR Fragment
0001 CGACCACCTA CCAGATCCTG CCGCCCAGCG TAGGACCTGC CACGGTGGCC AAGCGATACT 
0061 ATGCCACCAC TGGGCCGCAG ACCACGCATC CCACACATCC CAGCACCATC CAGATCACGA 
0121 ACAGTTTCGC TCAGCAATCA ACGCCACCGA AGCAACAGGC GGCAACA-AG CTGCAGCCCA 
0181 TTCAAGGCCA ACAACATACG AATCATCTCG ACGGCGCCAA GTGTATACAG TCTGAATAAG 
0241 CCGCCACAGG AAGCGCACTC CACATATGCT CCCGTTCAGT CGTACTACTT GCCCAGTGGC 
0301 GGTGGCCAAA CTGCGGGACA AATCAATCTA CTGGCGGCCA GCGGAACTGG CAAGCA-ACT 
0361 GCAGCCGCCG CCGCTGGTGC CTGTGACCAA TTCCACCTCA CCGCCCTCCA CCGTCGTGTT 
0421 AGACCGCATA AACATTTGCA TCAATAACCA CTATACGGAG ACGCCCACTT CGCTAAGTTC 
0481 ATCGCTTACC ACGGCCCAAC AA 
 Assemble Data

5109R-1.IR_full       1   CNACCACCTACCAGATCCTGCCGCCCAGCGTAGGACCTGCCACGGTGGCCAAGCGATACT 60
                          | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5109R-1.in silico     1   CGACCACCTACCAGATCCTGCCGCCCAGCGTAGGACCTGCCACGGTGGCCAAGCGATACT 60


5109R-1.IR_full       61  ATGCCACCACTGGGCCGCAGACCACGCATCCCACACATCCCAGCACCATCCAGATCACGA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5109R-1.in silico     61  ATGCCACCACTGGGCCGCAGACCACGCATCCCACACATCCCAGCACCATCCAGATCACGA 120


5109R-1.IR_full       121 ACAGTTTCGCTCAGCAATCAACGCCACCGAAGCAACAGGCGGCAACANAGCTGCAGCCCA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
5109R-1.in silico     121 ACAGTTTCGCTCAGCAATCAACGCCACCGAAGCAACAGGCGGCAACA-AGCTGCAGCCCA 180


5109R-1.IR_full       181 TTCAAGGCCAACAACATACGAATCATCTCGACGGCGCCAAGTGTATACAGTCTGAATAAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5109R-1.in silico     181 TTCAAGGCCAACAACATACGAATCATCTCGACGGCGCCAAGTGTATACAGTCTGAATAAG 240


5109R-1.IR_full       241 CCGCCACAGGAAGCGCACTCCACATATGCTCCCGTTCAGTCGTACTACTTGCCCAGTGGC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5109R-1.in silico     241 CCGCCACAGGAAGCGCACTCCACATATGCTCCCGTTCAGTCGTACTACTTGCCCAGTGGC 300


5109R-1.IR_full       301 GGTGGCCAAACTGCGGGACAAATCAATCTACTGGCGGCCAGCGGAACTGGCAAGCANACT 360
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
5109R-1.in silico     301 GGTGGCCAAACTGCGGGACAAATCAATCTACTGGCGGCCAGCGGAACTGGCAAGCA-ACT 360


5109R-1.IR_full       361 GCAGCCGCCGCCGCTGGTGCCTGTGACCAATTCCACCTCACCGCCCTCCACCGTCGTGTT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5109R-1.in silico     361 GCAGCCGCCGCCGCTGGTGCCTGTGACCAATTCCACCTCACCGCCCTCCACCGTCGTGTT 420


5109R-1.IR_full       421 AGACCGCATAAACATTTGCATCAATAACCACTATACGGAGACGCCCACTTCGCTAAGTTC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5109R-1.in silico     421 AGACCGCATAAACATTTGCATCAATAACCACTATACGGAGACGCCCACTTCGCTAAGTTC 480


5109R-1.IR_full       481 ATCGCTTACCACGGCCCAACAA 502
                          ||||||||||||||||||||||
5109R-1.in silico     481 ATCGCTTACCACGGCCCAACAA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057324.3  CG5109-RA (Pcl), mRNA 
0   NM_001038738.1  CG7803-RB, transcript variant B (z), mRNA 
0   NM_080312.2  CG7803-RA, transcript variant A (z), mRNA 
0   NM_057311.4  CG6246-RA (nub), mRNA 
0   17  NM_139536.1  CG11505-RB, transcript variant B (CG11505), mRNA 
0   17  NM_168007.1  CG11505-RA, transcript variant A (CG11505), mRNA 
0   10  NM_206263.1  CG11505-RC, transcript variant C (CG11505), mRNA 
0   NM_142259.2  CG10278-RA (GATAe), mRNA 
0   NM_135204.2  CG9596-RA, transcript variant A (CG9596), mRNA 
0   NM_205916.1  CG9596-RB, transcript variant B (CG9596), mRNA 
0   NM_164887.1  CG31714-RA (CG31714), mRNA 
0   NM_139863.3  CG8560-RA (CG8560), mRNA 
0   NM_134700.2  CG3561-RA (CG3561), mRNA 
0   NM_079051.2  CG4903-RA (MESR4), mRNA 
0   10  NM_170246.1  CG17367-RA, transcript variant A (Lnk), mRNA 
0   10  NM_143181.2  CG17367-RB, transcript variant B (Lnk), mRNA 
0   10  NM_170247.1  CG17367-RC, transcript variant C (Lnk), mRNA 
0   NM_135169.2  CG9493-RA (Pez), mRNA 
0   NM_176584.1  CG11504-RC, transcript variant C (CG11504), mRNA 
0   NM_143501.2  CG11504-RB, transcript variant B (CG11504), mRNA 
0   NM_170454.1  CG11504-RA, transcript variant A (CG11504), mRNA 
0   NM_170121.1  CG5991-RC, transcript variant C (CG5991), mRNA 
0   NM_142951.2  CG5991-RA, transcript variant A (CG5991), mRNA 
0   NM_170120.1  CG5991-RB, transcript variant B (CG5991), mRNA 
0   NM_169053.2  CG2663-RA, transcript variant A (CG2663), mRNA 
0   NM_141278.2  CG2663-RB, transcript variant B (CG2663), mRNA 
0   NM_132665.1  CG15753-RA (CG15753), mRNA 
0   NM_206372.1  CG7945-RC, transcript variant C (CG7945), mRNA 
0   NM_140516.1  CG7945-RB, transcript variant B (CG7945), mRNA 
0   NM_168624.1  CG7945-RA, transcript variant A (CG7945), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.