National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5105R-2 
 Symbol Plap  Full Name Phospholipase A2 activator protein 
 CG No CG5105  Old CG No CG5105 
 Synonyms CG5105, dPLAP, dmPLAP, Plap 
 Accession No (Link to NCBI) NM_079927.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTAGCGGTGGGACCTCCAACT 
 Primer Seq. 3'
aatctagaggtaccTTAAGCAGGCGCAGCTTCTCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GTAGCGGTGG GACCTCCAAC TCCGGAAGGT CGCCAGACCA TTCTGTCCGG TTCGCGGGAC 
0061 AAGAGCACCA AAGTCTGGAA GCCCCATGGG AACGAGTACT TGGAAAGCCT TACTTTGCAG 
0121 GACCACAAGA ACTTCATCTC GTACATCTGC TTCCTGGAGT CGGAGCGGTG GATCTGCACG 
0181 GCCAGCAACG ACGCCACCAT CTGCATCTAC AAGCAGGACG GCTTTGTGAC CCCTGTTGAC 
0241 CCTCAAGGGT CACGAGTCCA CGGTGTGTGC TCTCTCGGCA GGATTGGAGC CACGAAGCCT 
0301 CATCAGCGGC AGCTGGGACA AGACCGCTCG GGTGTGGACC ATCAGCGAGG CGGGTGATGT 
0361 GTCCTTCGTT GCTTTAGAGG GACACGAGGC GGCGGTTTGG GCGGTGGCCA CCTTGAAGGA 
0421 GCAGCGGAAG TATGTGACTG GTGGTGCGGA CAGGAACATC TACTACTGGA ACGCGAAAGG 
0481 CGAGAAGCTG CGCCTGCTTA A 
 in silico PCR Fragment
0001 GTAGCGGTGG GACCTCCAAC TCCGGAAGGT CGCCAGACCA TTCTGTCCGG TTCGCGGGAC 
0061 AAGAGCACCA AAGTCTGGAA GCCCCATGGG AACGAGTACT TGGAAAGCCT TACTTTGCAG 
0121 GACCACAAGA ACTTCATCTC GTACATCTGC TTCCTGGAGT CGGAGCGGTG GATCTGCACG 
0181 GCCAGCAACG ACGCCACCAT CTGCATCTAC AAGCAGGACG GCTTTGTG-C CCCTGTTGAC 
0241 CCTCAAGGGT CACGAGTCCA CGGTGTGTGC TCTCTCGGCA GGATTGGAGC CACGAAGCCT 
0301 CATCAGCGGC AGCTGGGACA AGACCGCTCG GGTGTGGACC ATCAGCGAGG CGGGTGATGT 
0361 GTCCTTCGTT GCTTTAGAGG GACACGAGGC GGCGGTTTGG GCGGTGGCCA CCTTGAAGGA 
0421 GCAGCGGAAG TATGTGACTG GTGGTGCGGA CAGGAACATC TACTACTGGA ACGCGAAAGG 
0481 CGAGAAGCTG CGCCTGCTTA A 
 Assemble Data

5105R-2.IR_full       1   GTAGCGGTGGGACCTCCAACTCCGGAAGGTCGCCAGACCATTCTGTCCGGTTCGCGGGAC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5105R-2.in silico     1   GTAGCGGTGGGACCTCCAACTCCGGAAGGTCGCCAGACCATTCTGTCCGGTTCGCGGGAC 60


5105R-2.IR_full       61  AAGAGCACCAAAGTCTGGAAGCCCCATGGGAACGAGTACTTGGAAAGCCTTACTTTGCAG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5105R-2.in silico     61  AAGAGCACCAAAGTCTGGAAGCCCCATGGGAACGAGTACTTGGAAAGCCTTACTTTGCAG 120


5105R-2.IR_full       121 GACCACAAGAACTTCATCTCGTACATCTGCTTCCTGGAGTCGGAGCGGTGGATCTGCACG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5105R-2.in silico     121 GACCACAAGAACTTCATCTCGTACATCTGCTTCCTGGAGTCGGAGCGGTGGATCTGCACG 180


5105R-2.IR_full       181 GCCAGCAACGACGCCACCATCTGCATCTACAAGCAGGACGGCTTTGTGACCCCTGTTGAC 240
                          |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
5105R-2.in silico     181 GCCAGCAACGACGCCACCATCTGCATCTACAAGCAGGACGGCTTTGTG-CCCCTGTTGAC 240


5105R-2.IR_full       241 CCTCAAGGGTCACGAGTCCACGGTGTGTGCTCTCTCGGCAGGATTGGAGCCACGAAGCCT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5105R-2.in silico     241 CCTCAAGGGTCACGAGTCCACGGTGTGTGCTCTCTCGGCAGGATTGGAGCCACGAAGCCT 300


5105R-2.IR_full       301 CATCAGCGGCAGCTGGGACAAGACCGCTCGGGTGTGGACCATCAGCGAGGCGGGTGATGT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5105R-2.in silico     301 CATCAGCGGCAGCTGGGACAAGACCGCTCGGGTGTGGACCATCAGCGAGGCGGGTGATGT 360


5105R-2.IR_full       361 GTCCTTCGTTGCTTTAGAGGGACACGAGGCGGCGGTTTGGGCGGTGGCCACCTTGAAGGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5105R-2.in silico     361 GTCCTTCGTTGCTTTAGAGGGACACGAGGCGGCGGTTTGGGCGGTGGCCACCTTGAAGGA 420


5105R-2.IR_full       421 GCAGCGGAAGTATGTGACTGGTGGTGCGGACAGGAACATCTACTACTGGAACGCGAAAGG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5105R-2.in silico     421 GCAGCGGAAGTATGTGACTGGTGGTGCGGACAGGAACATCTACTACTGGAACGCGAAAGG 480


5105R-2.IR_full       481 CGAGAAGCTGCGCCTGCTTAA 501
                          |||||||||||||||||||||
5105R-2.in silico     481 CGAGAAGCTGCGCCTGCTTAA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079927.2  CG5105-RA (Plap), mRNA 
0   NM_176712.1  CG33181-RA (CG33181), mRNA 
0   NM_136872.2  CG8290-RB, transcript variant B (CG8290), mRNA 
0   NM_170183.2  CG11120-RB, transcript variant B (CG11120), mRNA 
0   NM_143055.2  CG11120-RA, transcript variant A (CG11120), mRNA 
0   NM_164781.1  CG7392-RD, transcript variant D (Cka), mRNA 
0   NM_164780.1  CG7392-RC, transcript variant C (Cka), mRNA 
0   NM_135333.2  CG7392-RA, transcript variant A (Cka), mRNA 
0   NM_164779.1  CG7392-RB, transcript variant B (Cka), mRNA 
0   NM_141590.2  CG11964-RA (CG11964), mRNA 
0   NM_169103.1  CG10978-RB, transcript variant B (jagn), mRNA 
0   NM_141328.1  CG10978-RA, transcript variant A (jagn), mRNA 
0   NM_141041.1  CG11310-RA (CG11310), mRNA 
0   NM_166172.3  CG6262-RB, transcript variant B (CG6262), mRNA 
0   NM_137279.3  CG6262-RA, transcript variant A (CG6262), mRNA 
0   NM_176196.2  CG6262-RD, transcript variant D (CG6262), mRNA 
0   10  NM_135594.2  CG7294-RA (CG7294), mRNA 
0   NM_057534.3  CG3242-RA (sob), mRNA 
0   NM_138183.2  CG1225-RA, transcript variant A (RhoGEF3), mRNA 
0   NM_167823.1  CG1225-RB, transcript variant B (RhoGEF3), mRNA 
0   NM_167825.1  CG1225-RC, transcript variant C (RhoGEF3), mRNA 
0   NM_138031.1  CG3173-RA (CG3173), mRNA 
0   NM_167824.1  CG1225-RE, transcript variant E (RhoGEF3), mRNA 
0   15  NM_132412.1  CG9817-RA (CG9817), mRNA 
0   NM_206200.1  CG11206-RB, transcript variant B (CG11206), mRNA 
0   NM_137819.2  CG11206-RA, transcript variant A (CG11206), mRNA 
0   NM_168001.1  CG32271-RA (CG32271), mRNA 
0   NM_167101.1  CG3039-RB, transcript variant B (ogre), mRNA 
0   NM_080085.2  CG3039-RA, transcript variant A (ogre), mRNA 
0   NM_080157.2  CG11648-RB, transcript variant B (Abd-B), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.