National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5105R-1 
 Symbol Plap  Full Name Phospholipase A2 activator protein 
 CG No CG5105  Old CG No CG5105 
 Synonyms CG5105, dPLAP, dmPLAP, Plap 
 Accession No (Link to NCBI) NM_079927.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GTAGCGGTGGGACCTCCAACTCCGGAAGGTCGCCAGACCATTCTGTCCGGTTCGCGGGAC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AAGAGCACCAAAGTCTGGAAGCCCCATGGGAACGAGTACTTGGAAAGCCTTACTTTGCAG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GACCACAAGAACTTCATCTCGTACATCTGCTTCCTGGAGTCGGAGCGGTGGATCTGCACG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| silico     181 GCCAGCAACGACGCCACCATCTGCATCTACAAGCAGGACGGCTTTGTG-CCCCTGTTGAC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CCTCAAGGGTCACGAGTCCACGGTGTGTGCTCTCTCGGCAGGATTGGAGCCACGAAGCCT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CATCAGCGGCAGCTGGGACAAGACCGCTCGGGTGTGGACCATCAGCGAGGCGGGTGATGT 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GTCCTTCGTTGCTTTAGAGGGACACGAGGCGGCGGTTTGGGCGGTGGCCACCTTGAAGGA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GCAGCGGAAGTATGTGACTGGTGGTGCGGACAGGAACATCTACTACTGGAACGCGAAAGG 480

5105R-1.IR_full       481 CGAGAAGCTGCGCCTGCTTAA 501
                          ||||||||||||||||||||| silico     481 CGAGAAGCTGCGCCTGCTTAA 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079927.2  CG5105-RA (Plap), mRNA 
0   NM_176712.1  CG33181-RA (CG33181), mRNA 
0   NM_136872.2  CG8290-RB, transcript variant B (CG8290), mRNA 
0   NM_170183.2  CG11120-RB, transcript variant B (CG11120), mRNA 
0   NM_143055.2  CG11120-RA, transcript variant A (CG11120), mRNA 
0   NM_164781.1  CG7392-RD, transcript variant D (Cka), mRNA 
0   NM_164780.1  CG7392-RC, transcript variant C (Cka), mRNA 
0   NM_135333.2  CG7392-RA, transcript variant A (Cka), mRNA 
0   NM_164779.1  CG7392-RB, transcript variant B (Cka), mRNA 
0   NM_141590.2  CG11964-RA (CG11964), mRNA 
0   NM_169103.1  CG10978-RB, transcript variant B (jagn), mRNA 
0   NM_141328.1  CG10978-RA, transcript variant A (jagn), mRNA 
0   NM_141041.1  CG11310-RA (CG11310), mRNA 
0   NM_166172.3  CG6262-RB, transcript variant B (CG6262), mRNA 
0   NM_137279.3  CG6262-RA, transcript variant A (CG6262), mRNA 
0   NM_176196.2  CG6262-RD, transcript variant D (CG6262), mRNA 
0   10  NM_135594.2  CG7294-RA (CG7294), mRNA 
0   NM_057534.3  CG3242-RA (sob), mRNA 
0   NM_138183.2  CG1225-RA, transcript variant A (RhoGEF3), mRNA 
0   NM_167823.1  CG1225-RB, transcript variant B (RhoGEF3), mRNA 
0   NM_167825.1  CG1225-RC, transcript variant C (RhoGEF3), mRNA 
0   NM_138031.1  CG3173-RA (CG3173), mRNA 
0   NM_167824.1  CG1225-RE, transcript variant E (RhoGEF3), mRNA 
0   15  NM_132412.1  CG9817-RA (CG9817), mRNA 
0   NM_206200.1  CG11206-RB, transcript variant B (CG11206), mRNA 
0   NM_137819.2  CG11206-RA, transcript variant A (CG11206), mRNA 
0   NM_168001.1  CG32271-RA (CG32271), mRNA 
0   NM_167101.1  CG3039-RB, transcript variant B (ogre), mRNA 
0   NM_080085.2  CG3039-RA, transcript variant A (ogre), mRNA 
0   NM_080157.2  CG11648-RB, transcript variant B (Abd-B), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.