National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5083R-6 
 Symbol Rbf2  Full Name Retinoblastoma-family protein 2 
 CG No CG5083  Old CG No CG5083 
 Synonyms RBF2, rbf2, CG5083, Rbf2 
 Accession No (Link to NCBI) NM_079648.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTCAGCTGCGAGCAATTGGAG 
 Primer Seq. 3'
aatctagaggtaccCGAATGACCAGGAAGAGCAAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NTCAGCTGCG AGCAATTGGA GCTGGAANCG NGNAATTCAG CAAAGcGNTC TGTCCACCTA 
0061 CCATCGCTTG GATGCGGTCA ACGGGCTGTC CACCAGCGAG GCAGATGcCC AGGAGTGGCT 
0121 GTNTTGCGCC GTCTACAGCG AACTGCAGCg NTCGAAGATG CGcGNTATTA GGGAGTCCAT 
0181 CAACGAGGCA ACACGATTCG GTGGCCAAGA ACTGCTGCTG GAACGTGTCA CTAACNCGTC 
0241 TGTCTGCGCA GCTTTAAGAT GAACGTGTCC CAGTTTCTAC GCCGCATGGA GNACTGGAAT 
0301 TGGCTGACCC AAAACGAGAA CACTTTCCAG CTGGAGGTTG AGGAAcTGCG TTGTCGACTT 
0361 GGTATTACTT CGACGCTGCT GCGGCATTAT AAGCACANCT TTCGGAGCCT GTTCGTTCAC 
0421 CCCGGCAAGG GTgNGGACCC GGGTGCCGCG AATCACTACC AAGCGCTGTA TGAGTTCGGT 
0481 TGGTTGCTCT TCCTGGTCAT TCG 
 in silico PCR Fragment
0001 GTCAGCTGCG AGCAATTGGA GCTGGAAGCG AG-AATTCAG CAAAGCGCTC TGTCCACCTA 
0061 CCATCGCTTG GATGCGGTCA ACGGGCTGTC CACCAGCGAG GCAGATGCCC AGGAGTGGCT 
0121 GTGTTGCGCC GTCTACAGCG AACTGCAGCG CTCGAAGATG CGCGATATTA GGGAGTCCAT 
0181 CAACGAGGCA A-ACGATTCG GTGGCCAAGA ACTGCTGCTG GAACGTGTCA CTAACCCGTC 
0241 TG-CTGCGCA GCTTTAAGAT GAACGTGTCC CAGTTTCTAC GCCGCATGGA GCACTGGAAT 
0301 TGGCTGACCC AAAACGAGAA CACTTTCCAG CTGGAGGTTG AGGAACTGCG TTGTCGACTT 
0361 GGTATTACTT CGACGCTGCT GCGGCATTAT AAGCACATCT TTCGGAGCCT GTTCGTTCAC 
0421 CCCGGCAAGG GTGCGGACCC GGGTGCCGCG AATCACTACC AAGCGCTGTA TGAGTTCGGT 
0481 TGGTTGCTCT TCCTGGTCAT TCG 
 Assemble Data

5083R-6.IR_full        1   TCAGCTGCGAGCAATTGGAGCTGGAANCGNGNAATTCAGCAAAGCGNTCTGTCCACCTA 59
                           |||||||||||||||||||||||||| || | |||||||||||||| ||||||||||||
5083R-6.in silico      1   TCAGCTGCGAGCAATTGGAGCTGGAAGCGAG-AATTCAGCAAAGCGCTCTGTCCACCTA 59


5083R-6.IR_full       61  CCATCGCTTGGATGCGGTCAACGGGCTGTCCACCAGCGAGGCAGATGCCCAGGAGTGGCT 119
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5083R-6.in silico     61  CCATCGCTTGGATGCGGTCAACGGGCTGTCCACCAGCGAGGCAGATGCCCAGGAGTGGCT 119


5083R-6.IR_full       121 GTNTTGCGCCGTCTACAGCGAACTGCAGCGNTCGAAGATGCGCGNTATTAGGGAGTCCAT 179
                          || ||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||
5083R-6.in silico     121 GTGTTGCGCCGTCTACAGCGAACTGCAGCGCTCGAAGATGCGCGATATTAGGGAGTCCAT 179


5083R-6.IR_full       181 CAACGAGGCAACACGATTCGGTGGCCAAGAACTGCTGCTGGAACGTGTCACTAACNCGTC 239
                          ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||
5083R-6.in silico     181 CAACGAGGCAA-ACGATTCGGTGGCCAAGAACTGCTGCTGGAACGTGTCACTAACCCGTC 239


5083R-6.IR_full       241 TGTCTGCGCAGCTTTAAGATGAACGTGTCCCAGTTTCTACGCCGCATGGAGNACTGGAAT 299
                          || |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
5083R-6.in silico     241 TG-CTGCGCAGCTTTAAGATGAACGTGTCCCAGTTTCTACGCCGCATGGAGCACTGGAAT 299


5083R-6.IR_full       301 TGGCTGACCCAAAACGAGAACACTTTCCAGCTGGAGGTTGAGGAACTGCGTTGTCGACTT 359
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5083R-6.in silico     301 TGGCTGACCCAAAACGAGAACACTTTCCAGCTGGAGGTTGAGGAACTGCGTTGTCGACTT 359


5083R-6.IR_full       361 GGTATTACTTCGACGCTGCTGCGGCATTATAAGCACANCTTTCGGAGCCTGTTCGTTCAC 419
                          ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
5083R-6.in silico     361 GGTATTACTTCGACGCTGCTGCGGCATTATAAGCACATCTTTCGGAGCCTGTTCGTTCAC 419


5083R-6.IR_full       421 CCCGGCAAGGGTGNGGACCCGGGTGCCGCGAATCACTACCAAGCGCTGTATGAGTTCGGT 479
                          ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
5083R-6.in silico     421 CCCGGCAAGGGTGCGGACCCGGGTGCCGCGAATCACTACCAAGCGCTGTATGAGTTCGGT 479


5083R-6.IR_full       481 TGGTTGCTCTTCCTGGTCATTCG 502
                          |||||||||||||||||||||||
5083R-6.in silico     481 TGGTTGCTCTTCCTGGTCATTCG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079648.2  CG5083-RA (Rbf2), mRNA 
0.2   NM_143582.1  CG15552-RA (Sox100B), mRNA 
0   NM_168539.1  CG32119-RA (CG32119), mRNA 
0   NM_142145.2  CG7265-RA (CG7265), mRNA 
0   NM_141848.1  CG6908-RA (CG6908), mRNA 
0   NM_142827.1  CG6972-RA (CG6972), mRNA 
0   NM_170036.1  CG31239-RA (CG31239), mRNA 
0   NM_132525.1  CG15740-RA (CG15740), mRNA 
0   NM_175968.1  CG12787-RF, transcript variant F (hoe1), mRNA 
0   NM_175966.1  CG12787-RD, transcript variant D (hoe1), mRNA 
0   NM_175967.1  CG12787-RE, transcript variant E (hoe1), mRNA 
0   NM_164603.1  CG12787-RB, transcript variant B (hoe1), mRNA 
0   NM_135032.1  CG12787-RC, transcript variant C (hoe1), mRNA 
0   NM_135031.3  CG12787-RA, transcript variant A (hoe1), mRNA 
0   NM_141141.1  CG14459-RA (CG14459), mRNA 
0   NM_141702.2  CG12806-RA (Teh1), mRNA 
0   NM_078570.2  CG1763-RA (nod), mRNA 
0   NM_137166.3  CG7761-RA (pcs), mRNA 
0   NM_078609.2  CG11654-RA (Ahcy13), mRNA 
0   NM_001043247.1  CG6535-RB (tefu), mRNA 
0   NM_168420.1  CG32067-RA, transcript variant A (simj), mRNA 
0   NM_140150.2  CG32067-RC, transcript variant C (simj), mRNA 
0   NM_168421.1  CG32067-RB, transcript variant B (simj), mRNA 
0   NM_132393.2  CG2221-RA (l(1)G0289), mRNA 
0   NM_141115.1  CG14562-RA (CG14562), mRNA 
0   NM_140184.2  CG7628-RA (CG7628), mRNA 
0   11  NM_001014624.1  CG33555-RC, transcript variant C (btsz), mRNA 
0   NM_078793.4  CG9556-RB, transcript variant B (alien), mRNA 
0   NM_136372.2  CG3274-RA (Bap170), mRNA 
0   NM_164843.1  CG9556-RA, transcript variant A (alien), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.