National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5083R-2 
 Symbol Rbf2  Full Name Retinoblastoma-family protein 2 
 CG No CG5083  Old CG No CG5083 
 Synonyms RBF2, rbf2, CG5083, Rbf2 
 Accession No (Link to NCBI) NM_079648.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||| || | |||||||||||||| |||||||||||| silico      1   TCAGCTGCGAGCAATTGGAGCTGGAAGCGAG-AATTCAGCAAAGCGCTCTGTCCACCTA 59

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CCATCGCTTGGATGCGGTCAACGGGCTGTCCACCAGCGAGGCAGATGCCCAGGAGTGGCT 119

                          || ||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| silico     121 GTGTTGCGCCGTCTACAGCGAACTGCAGCGCTCGAAGATGCGCGATATTAGGGAGTCCAT 179

                          ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| silico     181 CAACGAGGCAA-ACGATTCGGTGGCCAAGAACTGCTGCTGGAACGTGTCACTAACCCGTC 239

                          || |||||||||||||||||||||||||||||||||||||||||||||||| |||||||| silico     241 TG-CTGCGCAGCTTTAAGATGAACGTGTCCCAGTTTCTACGCCGCATGGAGCACTGGAAT 299

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TGGCTGACCCAAAACGAGAACACTTTCCAGCTGGAGGTTGAGGAACTGCGTTGTCGACTT 359

                          ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| silico     361 GGTATTACTTCGACGCTGCTGCGGCATTATAAGCACATCTTTCGGAGCCTGTTCGTTCAC 419

                          ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| silico     421 CCCGGCAAGGGTGCGGACCCGGGTGCCGCGAATCACTACCAAGCGCTGTATGAGTTCGGT 479

5083R-2.IR_full       481 TGGTTGCTCTTCCTGGTCATTCG 502
                          ||||||||||||||||||||||| silico     481 TGGTTGCTCTTCCTGGTCATTCG 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079648.2  CG5083-RA (Rbf2), mRNA 
0.2   NM_143582.1  CG15552-RA (Sox100B), mRNA 
0   NM_168539.1  CG32119-RA (CG32119), mRNA 
0   NM_142145.2  CG7265-RA (CG7265), mRNA 
0   NM_141848.1  CG6908-RA (CG6908), mRNA 
0   NM_142827.1  CG6972-RA (CG6972), mRNA 
0   NM_170036.1  CG31239-RA (CG31239), mRNA 
0   NM_132525.1  CG15740-RA (CG15740), mRNA 
0   NM_175968.1  CG12787-RF, transcript variant F (hoe1), mRNA 
0   NM_175966.1  CG12787-RD, transcript variant D (hoe1), mRNA 
0   NM_175967.1  CG12787-RE, transcript variant E (hoe1), mRNA 
0   NM_164603.1  CG12787-RB, transcript variant B (hoe1), mRNA 
0   NM_135032.1  CG12787-RC, transcript variant C (hoe1), mRNA 
0   NM_135031.3  CG12787-RA, transcript variant A (hoe1), mRNA 
0   NM_141141.1  CG14459-RA (CG14459), mRNA 
0   NM_141702.2  CG12806-RA (Teh1), mRNA 
0   NM_078570.2  CG1763-RA (nod), mRNA 
0   NM_137166.3  CG7761-RA (pcs), mRNA 
0   NM_078609.2  CG11654-RA (Ahcy13), mRNA 
0   NM_001043247.1  CG6535-RB (tefu), mRNA 
0   NM_168420.1  CG32067-RA, transcript variant A (simj), mRNA 
0   NM_140150.2  CG32067-RC, transcript variant C (simj), mRNA 
0   NM_168421.1  CG32067-RB, transcript variant B (simj), mRNA 
0   NM_132393.2  CG2221-RA (l(1)G0289), mRNA 
0   NM_141115.1  CG14562-RA (CG14562), mRNA 
0   NM_140184.2  CG7628-RA (CG7628), mRNA 
0   11  NM_001014624.1  CG33555-RC, transcript variant C (btsz), mRNA 
0   NM_078793.4  CG9556-RB, transcript variant B (alien), mRNA 
0   NM_136372.2  CG3274-RA (Bap170), mRNA 
0   NM_164843.1  CG9556-RA, transcript variant A (alien), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.