National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5080R-4 
 Symbol CG5080  Full Name CG5080 
 CG No CG5080  Old CG No CG5080 
 Synonyms CT16297, CG5080 
 Accession No (Link to NCBI) NM_164406.1 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| silico     1   AGGAGAGCAGCCAGAAGGCGTCCGATCAGACCCAGAAGCGCCTCGAGGGTCTGCCCAAGG 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || silico      61  ACCGGAGCTGCTGTCCCAGATCGAAGCCAAGCTGCAAGAGCACGCGGCCAGCGTGACCA 119

                          |||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| silico     121 CCGCCGCTCCACCGAAGAACGCTGAGTTCGAGGC-CCAACTCCTGGAGCGTCTCACCTCG 179

                          ||||||||||||||||||||||| | ||||||||||||||||||||||||  |||||||| silico     181 CTGGGCGGCCAGGTGAGCTCTCTAAGCGAGACTGTGCAGCGACCAGCTGCTCCGGTTGGC 239

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||| silico     241 CTGAGCGAGACGGATCGCGCCTACATCCAGGAACTGAACAACGATACCCTGA-ATGCGCT 299

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GGCGCAGCTGAAGAGCGAGTCCTCGGTGGAACAGAAGTCAGCTGCGACGGAGGCCACGGA 359

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GCGACTGCAGCAGGCGGAGGCCAACATCCAGGCGGACGTTCGCCAGCTGTCCGCGGACGT 419

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GGGCATTCTCAACAAGCACTTCGCCTCGACTAACGAGAGCAATGCCAAGCTGAACGAGGG 479

5080R-4.IR_full       481 ACTCGAAGCGCTCGGTAACGTTC 502
                          |||||||||||||||||| |||| silico     481 ACTCGAAGCGCTCGGTAA-GTTC 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134734.2  CG5080-RB, transcript variant B (CG5080), mRNA 
100   482  NM_164406.1  CG5080-RA, transcript variant A (CG5080), mRNA 
0   NM_078713.2  CG17596-RA (S6kII), mRNA 
0   NM_138220.1  CG13889-RA (CG13889), mRNA 
0   NM_130488.2  CG3156-RA (CG3156), mRNA 
0   NM_165002.1  CG31762-RB, transcript variant B (aret), mRNA 
0   NM_206374.1  CG7450-RB, transcript variant B (CrebA), mRNA 
0   NM_079363.3  CG7450-RA, transcript variant A (CrebA), mRNA 
0   NM_132206.1  CG2253-RA (Upf2), mRNA 
0   13  NM_079258.2  CG5939-RA, transcript variant A (Prm), mRNA 
0   13  NM_168290.1  CG5939-RB, transcript variant B (Prm), mRNA 
0   NM_079164.2  CG5717-RA (yellow-g), mRNA 
0   NM_139584.1  CG14982-RB (CG14982), mRNA 
0   NM_057406.3  CG6222-RA (su(s)), mRNA 
0   NM_141001.2  CG4365-RA, transcript variant A (CG4365), mRNA 
0   NM_168873.1  CG4365-RC, transcript variant C (CG4365), mRNA 
0   NM_206502.1  CG3937-RD, transcript variant D (cher), mRNA 
0   NM_169746.1  CG3937-RB, transcript variant B (cher), mRNA 
0   NM_169747.1  CG3937-RC, transcript variant C (cher), mRNA 
0   NM_079659.2  CG3937-RA, transcript variant A (cher), mRNA 
0   NM_134983.2  CG4104-RA (Tps1), mRNA 
0   NM_169651.2  CG6156-RA, transcript variant A (CG6156), mRNA 
0   NM_142199.3  CG6156-RB, transcript variant B (CG6156), mRNA 
0   12  NM_176113.1  CG2049-RD, transcript variant D (Pkn), mRNA 
0   12  NM_176111.1  CG2049-RC, transcript variant C (Pkn), mRNA 
0   NM_176112.1  CG2049-RF, transcript variant F (Pkn), mRNA 
0   NM_176110.1  CG2049-RB, transcript variant B (Pkn), mRNA 
0   NM_141589.2  CG11963-RA (CG11963), mRNA 
0   NM_058032.3  CG12389-RA (Fpps), mRNA 
0   NM_132435.1  CG1582-RA (CG1582), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.