National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5080R-1 
 Symbol CG5080  Full Name CG5080 
 CG No CG5080  Old CG No CG5080 
 Synonyms CT16297, CG5080 
 Accession No (Link to NCBI) NM_164406.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGGAGAGCAGCCAGAAGGCGT 
 Primer Seq. 3'
aatctagaggtaccGAACTTACCGAGCGCTTCGAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGGAGAGCAG CCAGAAgGNG TCCGATNAGA CCCAGAAGCG CCTCGAGGGT CTGCCCAAgG 
0061 NACCGGAGCT GCTGTCCCAG ATCGAAGCCA AGCTGCAAGA GCACGCGGCC AGCGTGANCA 
0121 CCGCCGCTCC ACCGAAGAAC DCTGAGTTCG AGGCGCCAAC TCCTGGAGCG TCTCACCTCG 
0181 CTGGGCGGCC AGGTGAGCTC TCTGANCGAG ACTGTGCAGC GACCAGCTGc NNCGGTTGGC 
0241 CTGAGCGAGA CGGATCGCGC CTACATCCAG GAACTGAACA ACGATACCCT GANNTGCgct 
0301 GGCGCAGCTG AAGAGCGAGT CCTCGGTGGA ACAGAAGTCA GCTGCGACGG AGGCCACGGA 
0361 GCGACTGCAG CAgGCGGAGG CCAACATCCA GGCGGACGTT CGCCAgCTGT CCGCGGACGT 
0421 GGGCATTCTC AACAAGCACT TCGCCTCGaC TAACGAGAGC AATgCCAAGC TGAACGAGGG 
0481 ACTCGAAGCG CTCGGTAACG TTc 
 in silico PCR Fragment
0001 AGGAGAGCAG CCAGAAGGCG TCCGATCAGA CCCAGAAGCG CCTCGAGGGT CTGCCCAAGG 
0061 CACCGGAGCT GCTGTCCCAG ATCGAAGCCA AGCTGCAAGA GCACGCGGCC AGCGTGACCA 
0121 CCGCCGCTCC ACCGAAGAAC GCTGAGTTCG AGGC-CCAAC TCCTGGAGCG TCTCACCTCG 
0181 CTGGGCGGCC AGGTGAGCTC TCTAAGCGAG ACTGTGCAGC GACCAGCTGC TCCGGTTGGC 
0241 CTGAGCGAGA CGGATCGCGC CTACATCCAG GAACTGAACA ACGATACCCT GA-ATGCGCT 
0301 GGCGCAGCTG AAGAGCGAGT CCTCGGTGGA ACAGAAGTCA GCTGCGACGG AGGCCACGGA 
0361 GCGACTGCAG CAGGCGGAGG CCAACATCCA GGCGGACGTT CGCCAGCTGT CCGCGGACGT 
0421 GGGCATTCTC AACAAGCACT TCGCCTCGAC TAACGAGAGC AATGCCAAGC TGAACGAGGG 
0481 ACTCGAAGCG CTCGGTAA-G TTC 
 Assemble Data

5080R-1.IR_full       1   AGGAGAGCAGCCAGAAGGNGTCCGATNAGACCCAGAAGCGCCTCGAGGGTCTGCCCAAGG 60
                          |||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||
5080R-1.in silico     1   AGGAGAGCAGCCAGAAGGCGTCCGATCAGACCCAGAAGCGCCTCGAGGGTCTGCCCAAGG 60


5080R-1.IR_full        61  ACCGGAGCTGCTGTCCCAGATCGAAGCCAAGCTGCAAGAGCACGCGGCCAGCGTGANCA 119
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
5080R-1.in silico      61  ACCGGAGCTGCTGTCCCAGATCGAAGCCAAGCTGCAAGAGCACGCGGCCAGCGTGACCA 119


5080R-1.IR_full       121 CCGCCGCTCCACCGAAGAACDCTGAGTTCGAGGCGCCAACTCCTGGAGCGTCTCACCTCG 179
                          |||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||
5080R-1.in silico     121 CCGCCGCTCCACCGAAGAACGCTGAGTTCGAGGC-CCAACTCCTGGAGCGTCTCACCTCG 179


5080R-1.IR_full       181 CTGGGCGGCCAGGTGAGCTCTCTGANCGAGACTGTGCAGCGACCAGCTGCNNCGGTTGGC 239
                          ||||||||||||||||||||||| | ||||||||||||||||||||||||  ||||||||
5080R-1.in silico     181 CTGGGCGGCCAGGTGAGCTCTCTAAGCGAGACTGTGCAGCGACCAGCTGCTCCGGTTGGC 239


5080R-1.IR_full       241 CTGAGCGAGACGGATCGCGCCTACATCCAGGAACTGAACAACGATACCCTGANNTGCGCT 299
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||
5080R-1.in silico     241 CTGAGCGAGACGGATCGCGCCTACATCCAGGAACTGAACAACGATACCCTGA-ATGCGCT 299


5080R-1.IR_full       301 GGCGCAGCTGAAGAGCGAGTCCTCGGTGGAACAGAAGTCAGCTGCGACGGAGGCCACGGA 359
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5080R-1.in silico     301 GGCGCAGCTGAAGAGCGAGTCCTCGGTGGAACAGAAGTCAGCTGCGACGGAGGCCACGGA 359


5080R-1.IR_full       361 GCGACTGCAGCAGGCGGAGGCCAACATCCAGGCGGACGTTCGCCAGCTGTCCGCGGACGT 419
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5080R-1.in silico     361 GCGACTGCAGCAGGCGGAGGCCAACATCCAGGCGGACGTTCGCCAGCTGTCCGCGGACGT 419


5080R-1.IR_full       421 GGGCATTCTCAACAAGCACTTCGCCTCGACTAACGAGAGCAATGCCAAGCTGAACGAGGG 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5080R-1.in silico     421 GGGCATTCTCAACAAGCACTTCGCCTCGACTAACGAGAGCAATGCCAAGCTGAACGAGGG 479


5080R-1.IR_full       481 ACTCGAAGCGCTCGGTAACGTTC 502
                          |||||||||||||||||| ||||
5080R-1.in silico     481 ACTCGAAGCGCTCGGTAA-GTTC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134734.2  CG5080-RB, transcript variant B (CG5080), mRNA 
100   482  NM_164406.1  CG5080-RA, transcript variant A (CG5080), mRNA 
0   NM_078713.2  CG17596-RA (S6kII), mRNA 
0   NM_138220.1  CG13889-RA (CG13889), mRNA 
0   NM_130488.2  CG3156-RA (CG3156), mRNA 
0   NM_165002.1  CG31762-RB, transcript variant B (aret), mRNA 
0   NM_206374.1  CG7450-RB, transcript variant B (CrebA), mRNA 
0   NM_079363.3  CG7450-RA, transcript variant A (CrebA), mRNA 
0   NM_132206.1  CG2253-RA (Upf2), mRNA 
0   13  NM_079258.2  CG5939-RA, transcript variant A (Prm), mRNA 
0   13  NM_168290.1  CG5939-RB, transcript variant B (Prm), mRNA 
0   NM_079164.2  CG5717-RA (yellow-g), mRNA 
0   NM_139584.1  CG14982-RB (CG14982), mRNA 
0   NM_057406.3  CG6222-RA (su(s)), mRNA 
0   NM_141001.2  CG4365-RA, transcript variant A (CG4365), mRNA 
0   NM_168873.1  CG4365-RC, transcript variant C (CG4365), mRNA 
0   NM_206502.1  CG3937-RD, transcript variant D (cher), mRNA 
0   NM_169746.1  CG3937-RB, transcript variant B (cher), mRNA 
0   NM_169747.1  CG3937-RC, transcript variant C (cher), mRNA 
0   NM_079659.2  CG3937-RA, transcript variant A (cher), mRNA 
0   NM_134983.2  CG4104-RA (Tps1), mRNA 
0   NM_169651.2  CG6156-RA, transcript variant A (CG6156), mRNA 
0   NM_142199.3  CG6156-RB, transcript variant B (CG6156), mRNA 
0   12  NM_176113.1  CG2049-RD, transcript variant D (Pkn), mRNA 
0   12  NM_176111.1  CG2049-RC, transcript variant C (Pkn), mRNA 
0   NM_176112.1  CG2049-RF, transcript variant F (Pkn), mRNA 
0   NM_176110.1  CG2049-RB, transcript variant B (Pkn), mRNA 
0   NM_141589.2  CG11963-RA (CG11963), mRNA 
0   NM_058032.3  CG12389-RA (Fpps), mRNA 
0   NM_132435.1  CG1582-RA (CG1582), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
+- 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.