National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5069R-3 
 Symbol croc  Full Name crocodile 
 CG No CG5069  Old CG No CG5069 
 Synonyms Dmfd1, FD1, fd78E, fd1, CG5069, croc, FoxC 
 Accession No (Link to NCBI) NM_079478.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCAGCGACCAGAACTCCTTTA 
 Primer Seq. 3'
aatctagaggtaccCACATCCTTCTTCTTGAAGCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCAGCGACCA GAACTCCTTT ACGCGCCACT ATGCCCAGAC CGCAGCCGGT TACgGATCCG 
0061 CATCcgCGGT GGCGGCGGCC AGCAGCgNCT CCGCTGCAGC AGCGGCACAT TACGCATACG 
0121 ACCAGTACTC CCGCTATCCG TACTCGGCCA GCGCCTACGG CCTGGGTGCC CCGCACCAGN 
0181 AACAAGGAGA TTGTAAAGCC ACCTTACTCG TACATCGCCC TGATAGCCAT GGCCATCCAG 
0241 AATGCGGCGG ACAAGAAGGT GACCCTGAAC GGGATCTATC AGTACATCAT GGAGCGATTT 
0301 CCCTACTATC GCGACAACAA GCAGGGCTGG CAGAACTCCA TTCGGCACAA TCTTAGCCTC 
0361 AACGAGTGCT TCGTGAAGGT GGCCCGCGAT GACAAGAAGC CCGGCAAGGG CTCCTACTGG 
0421 ACTCTGGATC CGGACTCCTA CAACATGTTC GACAACGGCT CCTTCCTTCG CCGGCGTCGC 
0481 CGCTTCAAGA AGAAGGATGT G 
 in silico PCR Fragment
0001 TCAGCGACCA GAACTCCTTT ACGCGCCACT ATGCCCAGAC CGCAGCCGGT TACGGATCCG 
0061 CATCCGCGGT GGCGGCGGCC AGCAGCGCCT CCGCTGCAGC AGCGGCACAT TACGCATACG 
0121 ACCAGTACTC CCGCTATCCG TACTCGGCCA GCGCCTACGG CCTGGGTGCC CCGCACCAG- 
0181 AACAAGGAGA TTGTAAAGCC ACCTTACTCG TACATCGCCC TGATAGCCAT GGCCATCCAG 
0241 AATGCGGCGG ACAAGAAGGT GACCCTGAAC GGGATCTATC AGTACATCAT GGAGCGATTT 
0301 CCCTACTATC GCGACAACAA GCAGGGCTGG CAGAACTCCA TTCGGCACAA TCTTAGCCTC 
0361 AACGAGTGCT TCGTGAAGGT GGCCCGCGAT GACAAGAAGC CCGGCAAGGG CTCCTACTGG 
0421 ACTCTGGATC CGGACTCCTA CAACATGTTC GACAACGGCT CCTTCCTTCG CCGGCGTCGC 
0481 CGCTTCAAGA AGAAGGATGT G 
 Assemble Data

5069R-3.IR_full       1   TCAGCGACCAGAACTCCTTTACGCGCCACTATGCCCAGACCGCAGCCGGTTACGGATCCG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5069R-3.in silico     1   TCAGCGACCAGAACTCCTTTACGCGCCACTATGCCCAGACCGCAGCCGGTTACGGATCCG 60


5069R-3.IR_full       61  CATCCGCGGTGGCGGCGGCCAGCAGCGNCTCCGCTGCAGCAGCGGCACATTACGCATACG 120
                          ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
5069R-3.in silico     61  CATCCGCGGTGGCGGCGGCCAGCAGCGCCTCCGCTGCAGCAGCGGCACATTACGCATACG 120


5069R-3.IR_full       121 ACCAGTACTCCCGCTATCCGTACTCGGCCAGCGCCTACGGCCTGGGTGCCCCGCACCAGN 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
5069R-3.in silico     121 ACCAGTACTCCCGCTATCCGTACTCGGCCAGCGCCTACGGCCTGGGTGCCCCGCACCAG- 180


5069R-3.IR_full       181 AACAAGGAGATTGTAAAGCCACCTTACTCGTACATCGCCCTGATAGCCATGGCCATCCAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5069R-3.in silico     181 AACAAGGAGATTGTAAAGCCACCTTACTCGTACATCGCCCTGATAGCCATGGCCATCCAG 240


5069R-3.IR_full       241 AATGCGGCGGACAAGAAGGTGACCCTGAACGGGATCTATCAGTACATCATGGAGCGATTT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5069R-3.in silico     241 AATGCGGCGGACAAGAAGGTGACCCTGAACGGGATCTATCAGTACATCATGGAGCGATTT 300


5069R-3.IR_full       301 CCCTACTATCGCGACAACAAGCAGGGCTGGCAGAACTCCATTCGGCACAATCTTAGCCTC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5069R-3.in silico     301 CCCTACTATCGCGACAACAAGCAGGGCTGGCAGAACTCCATTCGGCACAATCTTAGCCTC 360


5069R-3.IR_full       361 AACGAGTGCTTCGTGAAGGTGGCCCGCGATGACAAGAAGCCCGGCAAGGGCTCCTACTGG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5069R-3.in silico     361 AACGAGTGCTTCGTGAAGGTGGCCCGCGATGACAAGAAGCCCGGCAAGGGCTCCTACTGG 420


5069R-3.IR_full       421 ACTCTGGATCCGGACTCCTACAACATGTTCGACAACGGCTCCTTCCTTCGCCGGCGTCGC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5069R-3.in silico     421 ACTCTGGATCCGGACTCCTACAACATGTTCGACAACGGCTCCTTCCTTCGCCGGCGTCGC 480


5069R-3.IR_full       481 CGCTTCAAGAAGAAGGATGTG 501
                          |||||||||||||||||||||
5069R-3.in silico     481 CGCTTCAAGAAGAAGGATGTG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079478.3  CG5069-RA (croc), mRNA 
2.28   11  16  18  NM_079188.1  CG1132-RA (fd64A), mRNA 
0.82   27  NM_079772.1  CG11922-RA (fd96Cb), mRNA 
0.62   18  13  20  NM_057382.2  CG16738-RA (slp1), mRNA 
0.41   10  20  NM_057486.3  CG2939-RA (slp2), mRNA 
0.41   NM_136255.1  CG8679-RA (CG8679), mRNA 
0.2   12  12  29  NM_079818.2  CG10002-RA (fkh), mRNA 
0   23  35  NM_079090.2  CG3668-RA (fd59A), mRNA 
0   NM_176013.1  CG33114-RA (Gyc32E), mRNA 
0   NM_141239.1  CG17735-RA (CG17735), mRNA 
0   NM_170562.1  CG1815-RA, transcript variant A (CG1815), mRNA 
0   NM_143624.2  CG1815-RC, transcript variant C (CG1815), mRNA 
0   NM_170563.1  CG1815-RB, transcript variant B (CG1815), mRNA 
0   NM_136757.1  CG12934-RA (CG12934), mRNA 
0   NM_140154.1  CG12523-RA (CG12523), mRNA 
0   NM_057472.2  CG3299-RA (Vinc), mRNA 
0   NM_165773.2  CG2204-RC, transcript variant C (G-oalpha47A), mRNA 
0   NM_176124.2  CG2204-RD, transcript variant D (G-oalpha47A), mRNA 
0   NM_176125.2  CG2204-RE, transcript variant E (G-oalpha47A), mRNA 
0   NM_206080.1  CG2204-RH, transcript variant H (G-oalpha47A), mRNA 
0   NM_176126.2  CG2204-RF, transcript variant F (G-oalpha47A), mRNA 
0   NM_176127.2  CG2204-RG, transcript variant G (G-oalpha47A), mRNA 
0   NM_078960.4  CG2204-RA, transcript variant A (G-oalpha47A), mRNA 
0   NM_206079.1  CG2204-RI, transcript variant I (G-oalpha47A), mRNA 
0   NM_165772.3  CG2204-RB, transcript variant B (G-oalpha47A), mRNA 
0   11  NM_132647.1  CG2204-RB, transcript variant B (G-oalpha47A), mRNA,4,5-triphosphate kinase 2 CG1630-RA, transcript variant A (IP3K2), mRNA 
0   11  NM_167358.1  CG2204-RB, transcript variant B (G-oalpha47A), mRNA,4,5-triphosphate kinase 2 CG1630-RA, transcript variant A (IP3K2), mRNA,4,5-triphosphate kinase 2 CG1630-RB, transcript variant B (IP3K2), mRNA 
0   NM_167095.1  CG32743-RA (Smg1), mRNA 
0   NM_142747.1  CG13409-RA (CG13409), mRNA 
0   14  NM_168443.1  CG11799-RA, transcript variant A (Mnf), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.