National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5061R-4 
 Symbol capt  Full Name capulet 
 CG No CG33979  Old CG No CG5061 
 Synonyms CG33979, cyclase-associated protein, capping protein, CAP, Cap, acu, cap, Capt, Acap, l(2)06955, Dcap, CG5074, CG5061, BcDNA:LD24380, capt 
 Accession No (Link to NCBI) NM_001038780.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGTACGCCTGGTCCCACCAA 
 Primer Seq. 3'
aatctagaggtaccTGCGTCGAGGTCGGCTTCAGA 
 Predicted Fragment Size
573 
 IR fragment full Seq
0001 ATGTACGCCT GGTCCCACCA AAGGCCACGC CAAGTTATTA TTTTCGCCAT TTCGCCTGTG 
0061 TTCGCTACGC AGCTTCTCGT CAGTTCTAAT TGGAATACAA CTGCAGATCC TTGCAAATTC 
0121 ATCAGCAGCA AAAGAAGATA ACGAGCCGGA AGCCAAGCCC TCGGCCGCCG TCGACCACTT 
0181 GGAGAGCATT TGCGAGCGAC TGGAGACCCT CGTCGACCGA TTGGAACGGA CTCTAACAGC 
0241 GCCACAGCCG ATAGAACTGC CCACGCCCAC ACTCCCGCCT CCGCCAGCCG AAGAAGAAGA 
0301 AGCTCTTCCA GTTTTTGAAA AAGCAGAGAC ACCACCTCCA CCTCCCTCGC CGCCCAGCAG 
0361 CAACATGAGT GTCGCCGGAT TCGAGGACAT TGTGGCGGGT CCGCTGAGCC AATACCTAAC 
0421 TCTCTCCGCC AAAATTGGCG GCGATGTGGC GCAGCATGCG GAGCTCGTGA AGAgCGCCTT 
0481 TGGCTCCCAA CTGCAGTACG TGACGCTGGC CACCCAGATC GCCCAGCCGg cGCAGCCCAA 
0541 GCAGGCGGAG CTTCTGAAGC CGACCTCGAC GCA 
 in silico PCR Fragment
0001 ATGTACGCCT GGTCCCACCA AAGGCCACGC CAAGTTATTA TTTTCGCCAT TTCGCCGGTG 
0061 TTCGCTACGC AGCTTCTCGT CAGTTCTAAT TGGAATACAA CTGCAGATCC TTGCAAATTC 
0121 ATCAGCAGCA AAAGAAGATA ACGAGCCGGA AGCCAAGCCC TCGGCCGCCG TCGACCACTT 
0181 GGAGAGCATT TGCGAGCGAC TGGAGACCCT CGTCGACCGA TTGGAACGGA CTCTAACAGC 
0241 GCCACAGCCG ATAGAACTGC CCACGCCCAC ACTCCCGCCT CCGCCAGCCG AAGAAGAAGA 
0301 AGCTCTTCCA GTTTTTGAAA AAGCAGAGAC ACCACCTCCA CCTCCCTCGC CGCCCAGCAG 
0361 CAACATGAGT GTCGCCGGAT TCGAGGACAT TGTGGCGGGT CCGCTGAGCC AATACCTAAC 
0421 TCTCTCCGCC AAAATTGGCG GCGATGTGGC GCAGCATGCG GAGCTCGTGA AGAGCGCCTT 
0481 TGGCTCCCAA CTGCAGTACG TGACGCTGGC CACCCAGATC GCCCAGCCGG CGCAGCCCAA 
0541 GCAGGCGGAG CTTCTGAAGC CGACCTCGAC GCA 
 Assemble Data

5061R-4.IR_full       1   ATGTACGCCTGGTCCCACCAAAGGCCACGCCAAGTTATTATTTTCGCCATTTCGCCTGTG 60
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
5061R-4.in silico     1   ATGTACGCCTGGTCCCACCAAAGGCCACGCCAAGTTATTATTTTCGCCATTTCGCCGGTG 60


5061R-4.IR_full       61  TTCGCTACGCAGCTTCTCGTCAGTTCTAATTGGAATACAACTGCAGATCCTTGCAAATTC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5061R-4.in silico     61  TTCGCTACGCAGCTTCTCGTCAGTTCTAATTGGAATACAACTGCAGATCCTTGCAAATTC 120


5061R-4.IR_full       121 ATCAGCAGCAAAAGAAGATAACGAGCCGGAAGCCAAGCCCTCGGCCGCCGTCGACCACTT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5061R-4.in silico     121 ATCAGCAGCAAAAGAAGATAACGAGCCGGAAGCCAAGCCCTCGGCCGCCGTCGACCACTT 180


5061R-4.IR_full       181 GGAGAGCATTTGCGAGCGACTGGAGACCCTCGTCGACCGATTGGAACGGACTCTAACAGC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5061R-4.in silico     181 GGAGAGCATTTGCGAGCGACTGGAGACCCTCGTCGACCGATTGGAACGGACTCTAACAGC 240


5061R-4.IR_full       241 GCCACAGCCGATAGAACTGCCCACGCCCACACTCCCGCCTCCGCCAGCCGAAGAAGAAGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5061R-4.in silico     241 GCCACAGCCGATAGAACTGCCCACGCCCACACTCCCGCCTCCGCCAGCCGAAGAAGAAGA 300


5061R-4.IR_full       301 AGCTCTTCCAGTTTTTGAAAAAGCAGAGACACCACCTCCACCTCCCTCGCCGCCCAGCAG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5061R-4.in silico     301 AGCTCTTCCAGTTTTTGAAAAAGCAGAGACACCACCTCCACCTCCCTCGCCGCCCAGCAG 360


5061R-4.IR_full       361 CAACATGAGTGTCGCCGGATTCGAGGACATTGTGGCGGGTCCGCTGAGCCAATACCTAAC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5061R-4.in silico     361 CAACATGAGTGTCGCCGGATTCGAGGACATTGTGGCGGGTCCGCTGAGCCAATACCTAAC 420


5061R-4.IR_full       421 TCTCTCCGCCAAAATTGGCGGCGATGTGGCGCAGCATGCGGAGCTCGTGAAGAGCGCCTT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5061R-4.in silico     421 TCTCTCCGCCAAAATTGGCGGCGATGTGGCGCAGCATGCGGAGCTCGTGAAGAGCGCCTT 480


5061R-4.IR_full       481 TGGCTCCCAACTGCAGTACGTGACGCTGGCCACCCAGATCGCCCAGCCGGCGCAGCCCAA 540
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
5061R-4.in silico     481 TGGCTCCCAACTGCAGTACGTGACGCTGGCCACCCAGATCGCCCAGCCGGCGCAGCCCAA 540


5061R-4.IR_full       541 GCAGGCGGAGCTTCTGAAGCCGACCTCGACGCA 573
                          |||||||||||||||||||||||||||||||||
5061R-4.in silico     541 GCAGGCGGAGCTTCTGAAGCCGACCTCGACGCA 573

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   555  NM_001038780.1  CG33979-RA, transcript variant A (capt), mRNA 
75.49   419  NM_001038781.1  CG33979-RB, transcript variant B (capt), mRNA 
0.18   NM_134665.2  CG3345-RA (CG3345), mRNA 
0   10  NM_168111.3  CG32423-RA, transcript variant A (alan-shepard), mRNA 
0   NM_137299.1  CG5065-RA (CG5065), mRNA 
0   NM_176509.1  CG31247-RA, transcript variant A (tinc), mRNA 
0   NM_176510.1  CG31247-RD, transcript variant D (tinc), mRNA 
0   NM_169780.2  CG31247-RB, transcript variant B (tinc), mRNA 
0   NM_164930.1  CG31719-RA, transcript variant A (RluA-1), mRNA 
0   NM_164931.1  CG31719-RB, transcript variant B (RluA-1), mRNA 
0   NM_164932.1  CG31719-RC, transcript variant C (RluA-1), mRNA 
0   NM_168412.1  CG32062-RD, transcript variant D (CG32062), mRNA 
0   NM_168413.1  CG32062-RB, transcript variant B (CG32062), mRNA 
0   NM_168470.1  CG32085-RA (CG32085), mRNA 
0   NM_141533.2  CG7459-RA (Ctr1B), mRNA 
0   NM_001014568.1  CG33523-RB, transcript variant B (CG33523), mRNA 
0   NM_001014567.1  CG33523-RC, transcript variant C (CG33523), mRNA 
0   NM_001014566.1  CG33523-RA, transcript variant A (CG33523), mRNA 
0   NM_001014569.1  CG33523-RD, transcript variant D (CG33523), mRNA 
0   NM_165823.1  CG30028-RA (gammaTry), mRNA 
0   NM_165825.1  CG30025-RA (CG30025), mRNA 
0   NM_165824.1  CG30031-RA (CG30031), mRNA 
0   NM_057423.3  CG18444-RA (alphaTry), mRNA 
0   NM_078970.3  CG12351-RA (deltaTry), mRNA 
0   NM_167524.2  CG9819-RB, transcript variant B (CanA-14F), mRNA 
0   NM_167523.2  CG9819-RA, transcript variant A (CanA-14F), mRNA 
0   NM_176603.1  CG31000-RH, transcript variant H (heph), mRNA 
0   NM_140437.1  CG7345-RA (Sox21a), mRNA 
0   NM_140295.2  CG6811-RA (RhoGAP68F), mRNA 
0   NM_206356.2  CG33261-RB, transcript variant B (Trl), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.