National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 5061R-2 
 Symbol capt  Full Name capulet 
 CG No CG33979  Old CG No CG5061 
 Synonyms CG33979, cyclase-associated protein, capping protein, CAP, Cap, acu, cap, Capt, Acap, l(2)06955, Dcap, CG5074, CG5061, BcDNA:LD24380, capt 
 Accession No (Link to NCBI) NM_001038780.1 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Fernández BG, Gaspar P, Brás-Pereira C, Jezowska B, Rebelo SR, Janody F.
Actin-Capping Protein and the Hippo pathway regulate F-actin and tissue growth in Drosophila.
Development (2011) 138(11) 2337-46 [ PubMed ID = 21525075 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| silico     1   ATGTACGCCTGGTCCCACCAAAGGCCACGCCAAGTTATTATTTTCGCCATTTCGCCGGTG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TTCGCTACGCAGCTTCTCGTCAGTTCTAATTGGAATACAACTGCAGATCCTTGCAAATTC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ATCAGCAGCAAAAGAAGATAACGAGCCGGAAGCCAAGCCCTCGGCCGCCGTCGACCACTT 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GGAGAGCATTTGCGAGCGACTGGAGACCCTCGTCGACCGATTGGAACGGACTCTAACAGC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GCCACAGCCGATAGAACTGCCCACGCCCACACTCCCGCCTCCGCCAGCCGAAGAAGAAGA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AGCTCTTCCAGTTTTTGAAAAAGCAGAGACACCACCTCCACCTCCCTCGCCGCCCAGCAG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CAACATGAGTGTCGCCGGATTCGAGGACATTGTGGCGGGTCCGCTGAGCCAATACCTAAC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TCTCTCCGCCAAAATTGGCGGCGATGTGGCGCAGCATGCGGAGCTCGTGAAGAGCGCCTT 480

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     481 TGGCTCCCAACTGCAGTACGTGACGCTGGCCACCCAGATCGCCCAGCCGGCGCAGCCCAA 540

                          ||||||||||||||||||||||||||||||||| silico     541 GCAGGCGGAGCTTCTGAAGCCGACCTCGACGCA 573

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   555  NM_001038780.1  CG33979-RA, transcript variant A (capt), mRNA 
75.49   419  NM_001038781.1  CG33979-RB, transcript variant B (capt), mRNA 
0.18   NM_134665.2  CG3345-RA (CG3345), mRNA 
0   10  NM_168111.3  CG32423-RA, transcript variant A (alan-shepard), mRNA 
0   NM_137299.1  CG5065-RA (CG5065), mRNA 
0   NM_176509.1  CG31247-RA, transcript variant A (tinc), mRNA 
0   NM_176510.1  CG31247-RD, transcript variant D (tinc), mRNA 
0   NM_169780.2  CG31247-RB, transcript variant B (tinc), mRNA 
0   NM_164930.1  CG31719-RA, transcript variant A (RluA-1), mRNA 
0   NM_164931.1  CG31719-RB, transcript variant B (RluA-1), mRNA 
0   NM_164932.1  CG31719-RC, transcript variant C (RluA-1), mRNA 
0   NM_168412.1  CG32062-RD, transcript variant D (CG32062), mRNA 
0   NM_168413.1  CG32062-RB, transcript variant B (CG32062), mRNA 
0   NM_168470.1  CG32085-RA (CG32085), mRNA 
0   NM_141533.2  CG7459-RA (Ctr1B), mRNA 
0   NM_001014568.1  CG33523-RB, transcript variant B (CG33523), mRNA 
0   NM_001014567.1  CG33523-RC, transcript variant C (CG33523), mRNA 
0   NM_001014566.1  CG33523-RA, transcript variant A (CG33523), mRNA 
0   NM_001014569.1  CG33523-RD, transcript variant D (CG33523), mRNA 
0   NM_165823.1  CG30028-RA (gammaTry), mRNA 
0   NM_165825.1  CG30025-RA (CG30025), mRNA 
0   NM_165824.1  CG30031-RA (CG30031), mRNA 
0   NM_057423.3  CG18444-RA (alphaTry), mRNA 
0   NM_078970.3  CG12351-RA (deltaTry), mRNA 
0   NM_167524.2  CG9819-RB, transcript variant B (CanA-14F), mRNA 
0   NM_167523.2  CG9819-RA, transcript variant A (CanA-14F), mRNA 
0   NM_176603.1  CG31000-RH, transcript variant H (heph), mRNA 
0   NM_140437.1  CG7345-RA (Sox21a), mRNA 
0   NM_140295.2  CG6811-RA (RhoGAP68F), mRNA 
0   NM_206356.2  CG33261-RB, transcript variant B (Trl), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.