National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4965R-2 
 Symbol twe  Full Name twine 
 CG No CG4965  Old CG No CG4965 
 Synonyms twn, Cdc25, CG4965, TWINE, cdc25, l(2)35Fh, BG:DS02740.1, mat(2)synHB5, mat(2)syn[HB5], mat(2)syn-A, twe, Twe 
 Accession No (Link to NCBI) NM_057285.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AAGCGGCTAATGCTCGATGTGGAGGAAGAAGATGATGAAAGTGGAGCGTGTGGTCAGGAG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AATTTCGATCCCCATGATGCCGATATGGAATACCAGGCCAAAAGGCGAAAATCAGCCGTG 120

                          |||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||| silico     121 CAGG-AGACTCCGCTGCAATGGATGCTGAAGCGGCATATTCCTGCCAGCACCACCGTTCT 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GTCGCCCATCACCGAATTGTCGCAGAATATGAATGGAGCCCGCCTGGATGGCACTCCCAA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GTCCACCCAGAGAATCCCAGCCAACAGGACCCTGAATAACTTTAATAGCCTGTCCTCGCG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AACACTCGGCAGTTTCAGTAGCTCCTGCTCGAGTTACGAGTCGGGCAACTCGCTGGATGA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TGAGTACATGGACATGTTCGAAATGGAATCAGCCGAGAATCACAATCTTGAGTTGCCCGA 420

                          ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| silico     421 TGACTTGGAAGTGCTCCTCAGCGGACAGCTGAAATCGGAAAGCAATTTAGAGGAGATGTC 480

4965R-2.IR_full       481 CAACAAAAAAGGCTCCCTGCG 501
                          ||||||||||||||||||||| silico     481 CAACAAAAAAGGCTCCCTGCG 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057285.3  CG4965-RA (twe), mRNA 
0   24  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   24  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   NM_165270.1  CG31792-RA (CG31792), mRNA 
0   NM_169173.1  CG1019-RB, transcript variant B (Mlp84B), mRNA 
0   NM_057774.3  CG1019-RA, transcript variant A (Mlp84B), mRNA 
0   NM_130497.2  CG13363-RA (Suv4-20), mRNA 
0   NM_135873.2  CG12636-RA (CG12636), mRNA 
0   NM_135381.1  CG13385-RA (CG13385), mRNA 
0   NM_169453.1  CG10095-RA (dpr15), mRNA 
0   NM_135371.3  CG7627-RA (CG7627), mRNA 
0   NM_130685.1  CG14420-RA (CG14420), mRNA 
0   NM_176565.1  CG31092-RB, transcript variant B (LpR2), mRNA 
0   NM_170239.2  CG31092-RA, transcript variant A (LpR2), mRNA 
0   14  NM_079823.2  CG1395-RA (stg), mRNA 
0   NM_078569.2  CG1554-RA (RpII215), mRNA 
0   NM_170085.2  CG31414-RA (CG31414), mRNA 
0   NM_168899.1  CG32437-RA (CG32437), mRNA 
0   NM_001042819.1  CG5424-RF, transcript variant F (f), mRNA 
0   NM_176745.1  CG5424-RD, transcript variant D (f), mRNA 
0   NM_176746.1  CG5424-RC, transcript variant C (f), mRNA 
0   NM_167563.2  CG5424-RA, transcript variant A (f), mRNA 
0   NM_176747.1  CG5424-RE, transcript variant E (f), mRNA 
0   NM_078660.2  CG5424-RB, transcript variant B (f), mRNA 
0   NM_132989.2  CG8568-RA (CG8568), mRNA 
0   NM_078544.2  CG1689-RA (lz), mRNA 
0   NM_133031.1  CG6847-RA (CG6847), mRNA 
0   NM_141568.2  CG9797-RA (CG9797), mRNA 
0   NM_134765.2  CG14352-RA (CG14352), mRNA 
0   NM_131963.1  CG12681-RA (CG12681), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.