National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4965R-2 
 Symbol twe  Full Name twine 
 CG No CG4965  Old CG No CG4965 
 Synonyms twn, Cdc25, CG4965, TWINE, cdc25, l(2)35Fh, BG:DS02740.1, mat(2)synHB5, mat(2)syn[HB5], mat(2)syn-A, twe, Twe 
 Accession No (Link to NCBI) NM_057285.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAAGCGGCTAATGCTCGATGTG 
 Primer Seq. 3'
aatctagaggtaccCGCAGGGAGCCTTTTTTGTTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AAGCGGCTAA TGCTCGATGT GGAGGAAGAA GATGATGAAA GTGGAGCGTG TGGTCAGGAG 
0061 AATTTCGATC CCCATGATGC CGATATGGAA TACCAGGCCA AAAGGCGAAA ATCAGCCGTG 
0121 CAGGCAGACT CCGATGCAAT GGATGCTGAA GCGGCATATT CCTGCCAGCA CCACCGTTCT 
0181 GTCGCCCATC ACCGAATTGT CGCAGAATAT GAATGGAGCC CGCCTGGATG GCACTCCCAA 
0241 GTCCACCCAG AGAATCCCAG CCAACAGGAC CCTGAATAAC TTTAATAGCC TGTCCTCGCG 
0301 AACACTCGGC AGTTTCAGTA GCTCCTGCTC GAGTTACGAG TCGGGCAACT CGCTGGATGA 
0361 TGAGTACATG GACATGTTCG AAATGGAATC AGCCGAGAAT CACAATCTTG AGTTGCCCGA 
0421 TGACTTGGAA GTGCTTCTCA GCGGACAGCT GAAATCGGAA AGCAATTTAG AGGAGATGTC 
0481 CAACAAAAAA GGCTCCCTGC G 
 in silico PCR Fragment
0001 AAGCGGCTAA TGCTCGATGT GGAGGAAGAA GATGATGAAA GTGGAGCGTG TGGTCAGGAG 
0061 AATTTCGATC CCCATGATGC CGATATGGAA TACCAGGCCA AAAGGCGAAA ATCAGCCGTG 
0121 CAGG-AGACT CCGCTGCAAT GGATGCTGAA GCGGCATATT CCTGCCAGCA CCACCGTTCT 
0181 GTCGCCCATC ACCGAATTGT CGCAGAATAT GAATGGAGCC CGCCTGGATG GCACTCCCAA 
0241 GTCCACCCAG AGAATCCCAG CCAACAGGAC CCTGAATAAC TTTAATAGCC TGTCCTCGCG 
0301 AACACTCGGC AGTTTCAGTA GCTCCTGCTC GAGTTACGAG TCGGGCAACT CGCTGGATGA 
0361 TGAGTACATG GACATGTTCG AAATGGAATC AGCCGAGAAT CACAATCTTG AGTTGCCCGA 
0421 TGACTTGGAA GTGCTCCTCA GCGGACAGCT GAAATCGGAA AGCAATTTAG AGGAGATGTC 
0481 CAACAAAAAA GGCTCCCTGC G 
 Assemble Data

4965R-2.IR_full       1   AAGCGGCTAATGCTCGATGTGGAGGAAGAAGATGATGAAAGTGGAGCGTGTGGTCAGGAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4965R-2.in silico     1   AAGCGGCTAATGCTCGATGTGGAGGAAGAAGATGATGAAAGTGGAGCGTGTGGTCAGGAG 60


4965R-2.IR_full       61  AATTTCGATCCCCATGATGCCGATATGGAATACCAGGCCAAAAGGCGAAAATCAGCCGTG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4965R-2.in silico     61  AATTTCGATCCCCATGATGCCGATATGGAATACCAGGCCAAAAGGCGAAAATCAGCCGTG 120


4965R-2.IR_full       121 CAGGCAGACTCCGATGCAATGGATGCTGAAGCGGCATATTCCTGCCAGCACCACCGTTCT 180
                          |||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||
4965R-2.in silico     121 CAGG-AGACTCCGCTGCAATGGATGCTGAAGCGGCATATTCCTGCCAGCACCACCGTTCT 180


4965R-2.IR_full       181 GTCGCCCATCACCGAATTGTCGCAGAATATGAATGGAGCCCGCCTGGATGGCACTCCCAA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4965R-2.in silico     181 GTCGCCCATCACCGAATTGTCGCAGAATATGAATGGAGCCCGCCTGGATGGCACTCCCAA 240


4965R-2.IR_full       241 GTCCACCCAGAGAATCCCAGCCAACAGGACCCTGAATAACTTTAATAGCCTGTCCTCGCG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4965R-2.in silico     241 GTCCACCCAGAGAATCCCAGCCAACAGGACCCTGAATAACTTTAATAGCCTGTCCTCGCG 300


4965R-2.IR_full       301 AACACTCGGCAGTTTCAGTAGCTCCTGCTCGAGTTACGAGTCGGGCAACTCGCTGGATGA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4965R-2.in silico     301 AACACTCGGCAGTTTCAGTAGCTCCTGCTCGAGTTACGAGTCGGGCAACTCGCTGGATGA 360


4965R-2.IR_full       361 TGAGTACATGGACATGTTCGAAATGGAATCAGCCGAGAATCACAATCTTGAGTTGCCCGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4965R-2.in silico     361 TGAGTACATGGACATGTTCGAAATGGAATCAGCCGAGAATCACAATCTTGAGTTGCCCGA 420


4965R-2.IR_full       421 TGACTTGGAAGTGCTTCTCAGCGGACAGCTGAAATCGGAAAGCAATTTAGAGGAGATGTC 480
                          ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
4965R-2.in silico     421 TGACTTGGAAGTGCTCCTCAGCGGACAGCTGAAATCGGAAAGCAATTTAGAGGAGATGTC 480


4965R-2.IR_full       481 CAACAAAAAAGGCTCCCTGCG 501
                          |||||||||||||||||||||
4965R-2.in silico     481 CAACAAAAAAGGCTCCCTGCG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057285.3  CG4965-RA (twe), mRNA 
0   24  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   24  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   NM_165270.1  CG31792-RA (CG31792), mRNA 
0   NM_169173.1  CG1019-RB, transcript variant B (Mlp84B), mRNA 
0   NM_057774.3  CG1019-RA, transcript variant A (Mlp84B), mRNA 
0   NM_130497.2  CG13363-RA (Suv4-20), mRNA 
0   NM_135873.2  CG12636-RA (CG12636), mRNA 
0   NM_135381.1  CG13385-RA (CG13385), mRNA 
0   NM_169453.1  CG10095-RA (dpr15), mRNA 
0   NM_135371.3  CG7627-RA (CG7627), mRNA 
0   NM_130685.1  CG14420-RA (CG14420), mRNA 
0   NM_176565.1  CG31092-RB, transcript variant B (LpR2), mRNA 
0   NM_170239.2  CG31092-RA, transcript variant A (LpR2), mRNA 
0   14  NM_079823.2  CG1395-RA (stg), mRNA 
0   NM_078569.2  CG1554-RA (RpII215), mRNA 
0   NM_170085.2  CG31414-RA (CG31414), mRNA 
0   NM_168899.1  CG32437-RA (CG32437), mRNA 
0   NM_001042819.1  CG5424-RF, transcript variant F (f), mRNA 
0   NM_176745.1  CG5424-RD, transcript variant D (f), mRNA 
0   NM_176746.1  CG5424-RC, transcript variant C (f), mRNA 
0   NM_167563.2  CG5424-RA, transcript variant A (f), mRNA 
0   NM_176747.1  CG5424-RE, transcript variant E (f), mRNA 
0   NM_078660.2  CG5424-RB, transcript variant B (f), mRNA 
0   NM_132989.2  CG8568-RA (CG8568), mRNA 
0   NM_078544.2  CG1689-RA (lz), mRNA 
0   NM_133031.1  CG6847-RA (CG6847), mRNA 
0   NM_141568.2  CG9797-RA (CG9797), mRNA 
0   NM_134765.2  CG14352-RA (CG14352), mRNA 
0   NM_131963.1  CG12681-RA (CG12681), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.