National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4948R-1 
 Symbol Tequila  Full Name Tequila 
 CG No CG4821  Old CG No CG4948 
 Synonyms CG4948, CG18403, graal, SP72, CG18153, CK00198, anon-EST:ParkEST161, CG4821, BEST:GH18038, BEST:CK00198, Tequila, Teq, teq 
 Accession No (Link to NCBI) NM_140031.1 
 Inserted Chr. lll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTTATCGATCAGGCAGTGGCT 
 Primer Seq. 3'
aatctagaggtaccGCATTTGGCCAAATCCTTGTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NTTATCGATC AGGCAGTgGN TACCACAGCG AGCAGTCGGA ACCAGTTGGC TTATCAGCAA 
0061 CAGGGAACGC ACACTCGAGT TACGGAGGCG ACCAGCAGCA GCCTATTTAC CATCGGGATT 
0121 CGGCATGCCC GCCGCATTTT ACGGGTCTGG TTGCATATCC CCACGACTGT CATCGCTATG 
0181 TGAACTGCTT CGATGGCAGC CCCACCATTC AGACGTGTTC GCCCGGAACT CTGTTCAATG 
0241 ACAGGACCCA GGTGTGCGAT CATCCCAGCA ATGTGGTTTG CCCTTCAGCG GAATCTGCAT 
0301 CTACTCGACT GGGAAGACTT AGGCAATTAG ATAGTGAACC CAAGTGTCAA CCGGGAGTGA 
0361 ATGGATTGCA ACCGCATCCT TCGGATTGCA GCAAGTTTCT TAACTGCGCC AATGGTCAAG 
0421 CTTTTATTAT GGACTGCGCA CCAGGAACTG CTTTTAGTCC AGCATCACTG GTATGTGTGC 
0481 ACAAGGATTT GGCCAAATGC  
 in silico PCR Fragment
0001 CTTATCGATC AGGCAGTGGC TACCACAGCG AGCAGTCGGA ACCAGTTGGC TTATCAGCAA 
0061 CAGGGAACGC ACACTCGAGT TACGGAGGCG ACCAGCAGCA GCCTATTTAC CATCGGGATT 
0121 CGGCATGCCC GCCGCATTTT ACGGGTCTGG TTGCATATCC CCACGACTGT CATCGCTATG 
0181 TGAACTGCTT CGATGGCAGC CCCACCATTC AGACGTGTTC GCCCGGAACT CTGTTCAATG 
0241 ACAGGACCCA GGTGTGCGAT CATCCCAGCA ATGTGGTTTG CCCTTCAGCG GAATCTGCAT 
0301 CTACTCGACT GGGAAGACTT AGGCAATTAG ATAGTGAACC CAAGTGTCAA CCGGGAGTGA 
0361 ATGGATTGCA ACCGCATCCT TCGGATTGCA GCAAGTTTCT TAACTGCGCC AATGGTCAAG 
0421 CTTTTATTAT GGACTGCGCA CCAGGAACTG CTTTTAGTCC AGCATCACTG GTATGTGTGC 
0481 ACAAGGATTT GGCCAAATGC  
 Assemble Data

4948R-1.IR_full        1   TTATCGATCAGGCAGTGGNTACCACAGCGAGCAGTCGGAACCAGTTGGCTTATCAGCAA 59
                           |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
4948R-1.in silico      1   TTATCGATCAGGCAGTGGCTACCACAGCGAGCAGTCGGAACCAGTTGGCTTATCAGCAA 59


4948R-1.IR_full       61  CAGGGAACGCACACTCGAGTTACGGAGGCGACCAGCAGCAGCCTATTTACCATCGGGATT 119
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4948R-1.in silico     61  CAGGGAACGCACACTCGAGTTACGGAGGCGACCAGCAGCAGCCTATTTACCATCGGGATT 119


4948R-1.IR_full       121 CGGCATGCCCGCCGCATTTTACGGGTCTGGTTGCATATCCCCACGACTGTCATCGCTATG 179
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4948R-1.in silico     121 CGGCATGCCCGCCGCATTTTACGGGTCTGGTTGCATATCCCCACGACTGTCATCGCTATG 179


4948R-1.IR_full       181 TGAACTGCTTCGATGGCAGCCCCACCATTCAGACGTGTTCGCCCGGAACTCTGTTCAATG 239
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4948R-1.in silico     181 TGAACTGCTTCGATGGCAGCCCCACCATTCAGACGTGTTCGCCCGGAACTCTGTTCAATG 239


4948R-1.IR_full       241 ACAGGACCCAGGTGTGCGATCATCCCAGCAATGTGGTTTGCCCTTCAGCGGAATCTGCAT 299
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4948R-1.in silico     241 ACAGGACCCAGGTGTGCGATCATCCCAGCAATGTGGTTTGCCCTTCAGCGGAATCTGCAT 299


4948R-1.IR_full       301 CTACTCGACTGGGAAGACTTAGGCAATTAGATAGTGAACCCAAGTGTCAACCGGGAGTGA 359
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4948R-1.in silico     301 CTACTCGACTGGGAAGACTTAGGCAATTAGATAGTGAACCCAAGTGTCAACCGGGAGTGA 359


4948R-1.IR_full       361 ATGGATTGCAACCGCATCCTTCGGATTGCAGCAAGTTTCTTAACTGCGCCAATGGTCAAG 419
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4948R-1.in silico     361 ATGGATTGCAACCGCATCCTTCGGATTGCAGCAAGTTTCTTAACTGCGCCAATGGTCAAG 419


4948R-1.IR_full       421 CTTTTATTATGGACTGCGCACCAGGAACTGCTTTTAGTCCAGCATCACTGGTATGTGTGC 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4948R-1.in silico     421 CTTTTATTATGGACTGCGCACCAGGAACTGCTTTTAGTCCAGCATCACTGGTATGTGTGC 479


4948R-1.IR_full       481 ACAAGGATTTGGCCAAATGC 499
                          ||||||||||||||||||||
4948R-1.in silico     481 ACAAGGATTTGGCCAAATGC 499

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140031.1  CG4821-RA, transcript variant A (Tequila), mRNA 
100   482  NM_168314.1  CG4821-RD, transcript variant D (Tequila), mRNA 
100   482  NM_168315.1  CG4821-RC, transcript variant C (Tequila), mRNA 
0   NM_057982.3  CG2819-RA (Pph13), mRNA 
0   NM_137574.1  CG10081-RA (CG10081), mRNA 
0   NM_132977.1  CG12997-RA (CG12997), mRNA 
0   NM_134516.2  CG32529-RA, transcript variant A (CG32529), mRNA 
0   NM_167688.1  CG32529-RC, transcript variant C (CG32529), mRNA 
0   NM_001038766.1  CG32529-RD, transcript variant D (CG32529), mRNA 
0   NM_141384.2  CG15188-RA (Osi20), mRNA 
0   NM_079508.2  CG2534-RA, transcript variant A (cno), mRNA 
0   NM_169025.1  CG2534-RB, transcript variant B (cno), mRNA 
0   NM_138259.2  CG9165-RA (l(3)02640), mRNA 
0   NM_136000.2  CG6453-RA (CG6453), mRNA 
0   20  NM_166569.1  CG12781-RB, transcript variant B (nahoda), mRNA 
0   20  NM_079091.2  CG12781-RA, transcript variant A (nahoda), mRNA 
0   NM_134606.2  CG1486-RA, transcript variant A (CG1486), mRNA 
0   NM_167743.1  CG1486-RB, transcript variant B (CG1486), mRNA 
0   NM_168512.1  CG32113-RA (CG32113), mRNA 
0   NM_168793.1  CG9614-RC, transcript variant C (pip), mRNA 
0   NM_176356.1  CG9614-RF, transcript variant F (pip), mRNA 
0   NM_176351.1  CG9614-RJ, transcript variant J (pip), mRNA 
0   NM_176355.1  CG9614-RD, transcript variant D (pip), mRNA 
0   NM_176352.1  CG9614-RI, transcript variant I (pip), mRNA 
0   NM_079434.2  CG9614-RA, transcript variant A (pip), mRNA 
0   NM_176359.1  CG9614-RK, transcript variant K (pip), mRNA 
0   NM_176357.1  CG9614-RE, transcript variant E (pip), mRNA 
0   NM_176358.1  CG9614-RL, transcript variant L (pip), mRNA 
0   NM_176353.1  CG9614-RH, transcript variant H (pip), mRNA 
0   NM_176149.1  CG33145-RA, transcript variant A (CG33145), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.