National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4935R-1 
 Symbol CG4935  Full Name CG4935 
 CG No CG4935  Old CG No CG4935 
 Synonyms MET30, BG:DS02740.2, CG4935 
 Accession No (Link to NCBI) NM_135938.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAATCCGGCATCGGGATTACT 
 Primer Seq. 3'
aatctagaggtaccCCAGCAGACGAACCACACTAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GAATCCGGCA TCGGGATTAC TGCTTAAGAC TTATGGTGGT CATGCGGATG AAGTCACCGA 
0061 TGCGGCGGGA AGCTGTGATA GTAGCTATAT CGTTTCCGCC AGCTTGGATA AAAGCATTAT 
0121 CTACTGGGAC GTGTCAACGG GAGCACCAGT ACGGCGCCTG CGTAGCCATG CCGGAGGTGT 
0181 TAGATGCGTC TGCTTCAACG AGGACTCCTC GATAGCCATT TCCGGGGGTC GAGATAATGC 
0241 CGTAATGTGC TGGGACATTC GAACGCGTCG CCTGGATCCC GTTCAGGTGA TGAAGGAGGC 
0301 CCGGGACTGC ATCACCACGG TGGCAACCAA CGAGAATCGC ATCTACGCCG CCTCCTTGGA 
0361 CGGATGTGTG AGGACCTACG ATATTCGGGT GGGCGAACTT ACCTGCGACA AAATTGGTGA 
0421 ACCCATCACA TATNCTGGCG CAGACGCGCG ACGAGCAATG TCTGGTGGCC GGCTGTCAGG 
0481 ATAGTGTGGT TCGTCTGCTG G 
 in silico PCR Fragment
0001 GAATCCGGCA TCGGGATTAC TGCTTAAGAC TTATGGTGGT CATGCGGATG AAGTCACCGA 
0061 TGCGGCGGGA AGCTGTGATA GTAGCTATAT CGTTTCCGCC AGCTTGGATA AAAGCATTAT 
0121 CTACTGGGAC GTGTCAACGG GAGCACCAGT ACGGCGCCTG CGTAGCCATG CCGGAGGTGT 
0181 TAGATGCGTC TGCTTCAACG AGGACTCCTC GATAGCCATT TCCGGGGGTC GAGATAATGC 
0241 CGTAATGTGC TGGGACATTC GAACGCGTCG CCTGGATCCC GTTCAGGTGA TGAAGGAGGC 
0301 CCGGGACTGC ATCACCACGG TGGCAACCAA CGAGAATCGC ATCTACGCCG CCTCCTTGGA 
0361 CGGATGTGTG AGGACCTACG ATATTCGGGT GGGCGAACTT ACCTGCGACA AAATTGGTGA 
0421 ACCCATCACA TAT-CTGGCG CAGACGCGCG ACGAGCAATG TCTGGTGGCC GGCTGTCAGG 
0481 ATAGTGTGGT TCGTCTGCTG G 
 Assemble Data

4935R-1.IR_full       1   GAATCCGGCATCGGGATTACTGCTTAAGACTTATGGTGGTCATGCGGATGAAGTCACCGA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4935R-1.in silico     1   GAATCCGGCATCGGGATTACTGCTTAAGACTTATGGTGGTCATGCGGATGAAGTCACCGA 60


4935R-1.IR_full       61  TGCGGCGGGAAGCTGTGATAGTAGCTATATCGTTTCCGCCAGCTTGGATAAAAGCATTAT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4935R-1.in silico     61  TGCGGCGGGAAGCTGTGATAGTAGCTATATCGTTTCCGCCAGCTTGGATAAAAGCATTAT 120


4935R-1.IR_full       121 CTACTGGGACGTGTCAACGGGAGCACCAGTACGGCGCCTGCGTAGCCATGCCGGAGGTGT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4935R-1.in silico     121 CTACTGGGACGTGTCAACGGGAGCACCAGTACGGCGCCTGCGTAGCCATGCCGGAGGTGT 180


4935R-1.IR_full       181 TAGATGCGTCTGCTTCAACGAGGACTCCTCGATAGCCATTTCCGGGGGTCGAGATAATGC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4935R-1.in silico     181 TAGATGCGTCTGCTTCAACGAGGACTCCTCGATAGCCATTTCCGGGGGTCGAGATAATGC 240


4935R-1.IR_full       241 CGTAATGTGCTGGGACATTCGAACGCGTCGCCTGGATCCCGTTCAGGTGATGAAGGAGGC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4935R-1.in silico     241 CGTAATGTGCTGGGACATTCGAACGCGTCGCCTGGATCCCGTTCAGGTGATGAAGGAGGC 300


4935R-1.IR_full       301 CCGGGACTGCATCACCACGGTGGCAACCAACGAGAATCGCATCTACGCCGCCTCCTTGGA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4935R-1.in silico     301 CCGGGACTGCATCACCACGGTGGCAACCAACGAGAATCGCATCTACGCCGCCTCCTTGGA 360


4935R-1.IR_full       361 CGGATGTGTGAGGACCTACGATATTCGGGTGGGCGAACTTACCTGCGACAAAATTGGTGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4935R-1.in silico     361 CGGATGTGTGAGGACCTACGATATTCGGGTGGGCGAACTTACCTGCGACAAAATTGGTGA 420


4935R-1.IR_full       421 ACCCATCACATATNCTGGCGCAGACGCGCGACGAGCAATGTCTGGTGGCCGGCTGTCAGG 480
                          ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
4935R-1.in silico     421 ACCCATCACATAT-CTGGCGCAGACGCGCGACGAGCAATGTCTGGTGGCCGGCTGTCAGG 480


4935R-1.IR_full       481 ATAGTGTGGTTCGTCTGCTGG 501
                          |||||||||||||||||||||
4935R-1.in silico     481 ATAGTGTGGTTCGTCTGCTGG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135938.2  CG4935-RA (CG4935), mRNA 
0   NM_130652.2  CG8310-RA (CG8310), mRNA 
0   NM_132716.1  CG13403-RA (CG13403), mRNA 
0   NM_169672.1  CG4699-RB, transcript variant B (CG4699), mRNA 
0   NM_142235.1  CG4699-RA, transcript variant A (CG4699), mRNA 
0   NM_169673.1  CG4699-RC, transcript variant C (CG4699), mRNA 
0   NM_137032.2  CG5970-RA (CG5970), mRNA 
0   NM_130639.2  CG2918-RA (CG2918), mRNA 
0   NM_132431.2  CG1655-RA (sofe), mRNA 
0   NM_132779.1  CG15028-RB, transcript variant B (CG15028), mRNA 
0   NM_167431.1  CG15028-RA, transcript variant A (CG15028), mRNA 
0   NM_139680.1  CG17150-RA, transcript variant A (CG17150), mRNA 
0   NM_176581.2  CG33204-RA (CG33204), mRNA 
0   NM_078981.2  CG8967-RA (otk), mRNA 
0   NM_168153.1  CG32406-RA (CG32406), mRNA 
0   NM_167170.1  CG10701-RC, transcript variant C (Moe), mRNA 
0   NM_167169.1  CG10701-RA, transcript variant A (Moe), mRNA 
0   NM_167168.1  CG10701-RB, transcript variant B (Moe), mRNA 
0   NM_080343.2  CG10701-RD, transcript variant D (Moe), mRNA 
0   NM_206664.1  CG10701-RJ, transcript variant J (Moe), mRNA 
0   NM_206665.1  CG10701-RI, transcript variant I (Moe), mRNA 
0   NM_206669.1  CG10701-RE, transcript variant E (Moe), mRNA 
0   NM_206666.1  CG10701-RH, transcript variant H (Moe), mRNA 
0   NM_206668.1  CG10701-RF, transcript variant F (Moe), mRNA 
0   NM_206667.1  CG10701-RG, transcript variant G (Moe), mRNA 
0   NM_132981.1  CG8675-RA (CG8675), mRNA 
0   NM_135657.1  CG14925-RA (Osi21), mRNA 
0   NM_143647.1  CG2053-RA (CG2053), mRNA 
0   NM_132703.2  CG32626-RC, transcript variant C (CG32626), mRNA 
0   NM_134961.1  CG10019-RA (CG10019), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.