National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4930R-1 
 Symbol CG4930  Full Name CG4930 
 CG No CG4930  Old CG No CG4930 
 Synonyms BG:DS07473.2, CG4930 
 Accession No (Link to NCBI) NM_135937.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Molnar C, Casado M, López-Varea A, Cruz C, de Celis JF.
Genetic annotation of gain-of-function screens using RNA interference and in situ hybridization of candidate genes in the Drosophila wing.
Genetics (2012) 192(2) 741-52 [ PubMed ID = 22798488 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment balanced with SM6a, Cy 
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGCAATCGAACACAGAGAAGG 
 Primer Seq. 3'
aatctagaggtaccTCTTCTTCACGCTGGCCTGGT 
 Predicted Fragment Size
501 
 IR fragment full Seq
0001 CGCAATCGAA CACAGAGAAG GCCAGCCAAT TGCTGGAGGA ATACCGTGGT GACGCCTGCT 
0061 TCTACGACCC GACGCCGTAC AACGAATGGA TTGTCAAGCT GAGGGATGAG GTTCTAAAGA 
0121 AGGAACTCCT CGACTTTTGG CGCGATGTGC TGGTGAAGAA GCAACTCGGT CCCTGTTGGT 
0181 CACGCGACAG TGATCTCTTT GACAGCGACG ACACCCCGCC ATTGGAGTTC TATGCCCATG 
0241 CCGGTTGTAC CGCTCCATTT GCAGCCAGCT TAAAGGTGCG CGCAGCACTC GAGGAGCAGG 
0301 CTTCGCTGGA TCAGGATGGG CCAGCGACGC CTACAACTCC GGGTGAACTG AGTGCCGATG 
0361 ATGCCGCCGC TCTGTCTGGC GAATTTGAGG CCACCCTGAC CAAGGAAAAT CCTCTCGAAG 
0421 AATACCGAAC GCTAATGAAG CGCTTTGTCC TGACCAAAAT CATCGTTCCG GACAGCGTTC 
0481 ACCAGGCCAG CGTGAAGAAG A 
 in silico PCR Fragment
0001 CGCAATCGAA CACAGAGAAG GCCAGCCAAT TGCTGGAGGA ATACCGTGGT GACGCCTGCT 
0061 TCTACGACCC GACGCCGTAC AACGAATGGA TTGTCAAGCT GAGGGATGAG GTTCTAAAGA 
0121 AGGAACTCCT CGACTTTTGG CGCGATGTGC TGGTGAAGAA GCAACTCGGT CCCTGTTGGT 
0181 CACGCGACAG TGATCTCTTT GACAGCGACG ACACCCCGCC ATTGGAGTTC TATGCCCATG 
0241 CCGGTTGTAC CGCTCCATTT GCAGCCAGCT TAAAGGTGCG CGCAGCACTC GAGGAGCAGG 
0301 CTTCGCTGGA TCAGGATGGG CCAGCGACGC CTACAACTCC GGGTGAACTG AGTGCCGATG 
0361 ATGCCGCCGC TCTGTCTGGC GAATTTGAGG CCACCCTGAC CAAGGAAAAT CCGCTCGAGG 
0421 AATACCGAAC TCTAATGAAG CGCTTTGTTC TGACCAAAAT CATCGTTCCG GACAGCGTTC 
0481 ACCAGGCCAG CGTGAAGAAG A 
 Assemble Data

4930R-1.IR_full       1   CGCAATCGAACACAGAGAAGGCCAGCCAATTGCTGGAGGAATACCGTGGTGACGCCTGCT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4930R-1.in silico     1   CGCAATCGAACACAGAGAAGGCCAGCCAATTGCTGGAGGAATACCGTGGTGACGCCTGCT 60


4930R-1.IR_full       61  TCTACGACCCGACGCCGTACAACGAATGGATTGTCAAGCTGAGGGATGAGGTTCTAAAGA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4930R-1.in silico     61  TCTACGACCCGACGCCGTACAACGAATGGATTGTCAAGCTGAGGGATGAGGTTCTAAAGA 120


4930R-1.IR_full       121 AGGAACTCCTCGACTTTTGGCGCGATGTGCTGGTGAAGAAGCAACTCGGTCCCTGTTGGT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4930R-1.in silico     121 AGGAACTCCTCGACTTTTGGCGCGATGTGCTGGTGAAGAAGCAACTCGGTCCCTGTTGGT 180


4930R-1.IR_full       181 CACGCGACAGTGATCTCTTTGACAGCGACGACACCCCGCCATTGGAGTTCTATGCCCATG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4930R-1.in silico     181 CACGCGACAGTGATCTCTTTGACAGCGACGACACCCCGCCATTGGAGTTCTATGCCCATG 240


4930R-1.IR_full       241 CCGGTTGTACCGCTCCATTTGCAGCCAGCTTAAAGGTGCGCGCAGCACTCGAGGAGCAGG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4930R-1.in silico     241 CCGGTTGTACCGCTCCATTTGCAGCCAGCTTAAAGGTGCGCGCAGCACTCGAGGAGCAGG 300


4930R-1.IR_full       301 CTTCGCTGGATCAGGATGGGCCAGCGACGCCTACAACTCCGGGTGAACTGAGTGCCGATG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4930R-1.in silico     301 CTTCGCTGGATCAGGATGGGCCAGCGACGCCTACAACTCCGGGTGAACTGAGTGCCGATG 360


4930R-1.IR_full       361 ATGCCGCCGCTCTGTCTGGCGAATTTGAGGCCACCCTGACCAAGGAAAATCCTCTCGAAG 420
                          |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
4930R-1.in silico     361 ATGCCGCCGCTCTGTCTGGCGAATTTGAGGCCACCCTGACCAAGGAAAATCCGCTCGAGG 420


4930R-1.IR_full       421 AATACCGAACGCTAATGAAGCGCTTTGTCCTGACCAAAATCATCGTTCCGGACAGCGTTC 480
                          |||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||
4930R-1.in silico     421 AATACCGAACTCTAATGAAGCGCTTTGTTCTGACCAAAATCATCGTTCCGGACAGCGTTC 480


4930R-1.IR_full       481 ACCAGGCCAGCGTGAAGAAGA 501
                          |||||||||||||||||||||
4930R-1.in silico     481 ACCAGGCCAGCGTGAAGAAGA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   483  14  NM_135937.2  CG4930-RA (CG4930), mRNA 
0   NM_141644.2  CG9379-RA (by), mRNA 
0   NM_137587.1  CG15122-RA (CG15122), mRNA 
0   NM_136878.2  CG8364-RB, transcript variant B (Rep3), mRNA 
0   NM_057517.2  CG4824-RA, transcript variant A (BicC), mRNA 
0   NM_165144.1  CG4824-RB, transcript variant B (BicC), mRNA 
0   NM_165145.1  CG4824-RD, transcript variant D (BicC), mRNA 
0   NM_141044.2  CG11309-RA, transcript variant A (CG11309), mRNA 
0   NM_133024.2  CG6769-RA (CG6769), mRNA 
0   NM_168896.1  CG11309-RB, transcript variant B (CG11309), mRNA 
0   NM_140583.1  CG12272-RA (CG12272), mRNA 
0   NM_140310.1  CG4328-RA (CG4328), mRNA 
0   NM_132343.2  CG3002-RB (Gga), mRNA 
0   NM_057391.3  CG1977-RA (alpha-Spec), mRNA 
0   NM_170480.1  CG2216-RC, transcript variant C (Fer1HCH), mRNA 
0   NM_170481.1  CG2216-RD, transcript variant D (Fer1HCH), mRNA 
0   NM_170482.1  CG2216-RE, transcript variant E (Fer1HCH), mRNA 
0   NM_170479.1  CG2216-RB, transcript variant B (Fer1HCH), mRNA 
0   NM_080134.2  CG2216-RA, transcript variant A (Fer1HCH), mRNA 
0   NM_131990.1  CG12732-RA (CG12732), mRNA 
0   NM_137891.1  CG3695-RA (MED23), mRNA 
0   NM_080516.1  CG16757-RA (Spn), mRNA 
0   NM_170620.2  CG12052-RD, transcript variant D (lola), mRNA 
0   NM_170621.3  CG12052-RE, transcript variant E (lola), mRNA 
0   NM_141173.1  CG11133-RA (CG11133), mRNA 
0   NM_142815.2  CG6949-RA (mRpL45), mRNA 
0   NM_143233.2  CG31080-RA (CG31080), mRNA 
0   NM_134789.1  CG15356-RA (CG15356), mRNA 
0   NM_169806.1  CG31235-RA (CG31235), mRNA 
0   NM_141453.2  CG1234-RA (CG1234), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
DC
++ 
DM
VM
+- 
VB
 
Caspase-3 signal
N
DB
++ 
DC
++ 
DM
VM
VB
++ 
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.