National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4896Ra-3 
 Symbol CG4896  Full Name CG4896 
 CG No CG4896  Old CG No CG4896 
 Synonyms cg4896, CG4896 
 Accession No (Link to NCBI) NM_164410.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATCGGGCTACAGACGCTACAG 
 Primer Seq. 3'
aatctagaggtaccACCGTCTATCTCGATCGCGCT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATCGGGNTAC AGACGCTACA GTCGCTCCCG ATCCCGATCC AGGGAACGAA NTCGGGACCG 
0061 CAATGAGTAC AGACGTCGCA ACTCCCGTTC GCGCAGTCGG GAGCGGTCCT CACACTATAG 
0121 AAACGACCGC AGTCCGGATC GCGATCTGTA CCGCGACCTG ATCAACGAGG ATTACGAGGA 
0181 TCAGGGAAAC TACAACTCGA GACAGAACCT TGACCATCGC CAGCGCNANG CGAGGACAAA 
0241 TACGATCGTC GGCATGATGA TAGCCAGGGT CGCAGGGATC ACGATAGCTA CAGCAACCAA 
0301 AGCAACTACG ACAAGAGTGG CCAGGATATG GATAAGGACC GCGATCACCG CTGGAAAAAC 
0361 TACGATCGCG TTTCGAGAGA GCGCAACCAT GATGACTTCG ATCGGGGATC GGAGCGCAGC 
0421 AGCCGCAGCA ATGACCAGCG GCAGTTCAAT AATAATGGAA ATAGTAACTC CAGCAGCAGT 
0481 TACAGAGATC GCGAGAAGGA GCGCGATCGA GATAGACGGT  
 in silico PCR Fragment
0001 ATCGGGCTAC AGACGCTACA GTCGCTCCCG ATCCCGATCC AGGGAACGAA GTCGGGACCG 
0061 CAATGAGTAC AGACGTCGCA ACTCCCGTTC GCGCAGTCGG GAGCGGTCCT CACACTATAG 
0121 AAACGACCGC AGTCCGGATC GCGATCTGTA CCGCGACCTG ATCAACGAGG ATTACGAGGA 
0181 TCAGGGAAAC TACAACTCGA GACAGAACCT TGACCAGCGC CA-CG----G CGAGGACAAA 
0241 TACGATCGTC GGCATGCTGA TAGCCAGGGT CGCAGGGATC ACGAT----- ---------- 
0301 AGCAACTACG ACAAGAGTGG CCAGGATATG GATAAGGA-C CGCGATCACC GCTGGAAAAA 
0361 CTACGATCGC GTTTCGAGAG AGCGCAACCA TGATGACTTC GATCGGGGAT CGGAGCGCAG 
0421 CAGCCGCAGC AATGACCAGC GGCAGTTCAA TAATAATGGA AATAGTAACT CCAGCAGCAG 
0481 TTACAGAGAT CGCGAGAAGG AGCGCGATCG AGATAGACGG T 
 Assemble Data

4896Ra-3.IR full       1   ATCGGGNTACAGACGCTACAGTCGCTCCCGATCCCGATCCAGGGAACGAANTCGGGACCG 60
                           |||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||
4896Ra-3.in silico     1   ATCGGGCTACAGACGCTACAGTCGCTCCCGATCCCGATCCAGGGAACGAAGTCGGGACCG 60


4896Ra-3.IR full       61  CAATGAGTACAGACGTCGCAACTCCCGTTCGCGCAGTCGGGAGCGGTCCTCACACTATAG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4896Ra-3.in silico     61  CAATGAGTACAGACGTCGCAACTCCCGTTCGCGCAGTCGGGAGCGGTCCTCACACTATAG 120


4896Ra-3.IR full       121 AAACGACCGCAGTCCGGATCGCGATCTGTACCGCGACCTGATCAACGAGGATTACGAGGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4896Ra-3.in silico     121 AAACGACCGCAGTCCGGATCGCGATCTGTACCGCGACCTGATCAACGAGGATTACGAGGA 180


4896Ra-3.IR full       181 TCAGGGAAACTACAACTCGAGACAGAACCTTGACCATCGCCAGCGCNANGCGAGGACAAA 240
                           |||||||||||||||||||||||||||||||||||| |||||       |||||||||||
4896Ra-3.in silico     181 TCAGGGAAACTACAACTCGAGACAGAACCTTGACCAGCGCCA-----CGGCGAGGACAAA 240


4896Ra-3.IR full       241 TACGATCGTCGGCATGATGATAGCCAGGGTCGCAGGGATCACGATAGCTACAGCAACCAA 300
                           |||||||||||||||| |||||||||||||||||||||||||||||||            
4896Ra-3.in silico     241 TACGATCGTCGGCATGCTGATAGCCAGGGTCGCAGGGATCACGATAGC------------ 300


4896Ra-3.IR full       301 AGCAACTACGACAAGAGTGGCCAGGATATGGATAAGGACCGCGATCACCGCTGGAAAAAC 360
                              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4896Ra-3.in silico     301 ---AACTACGACAAGAGTGGCCAGGATATGGATAAGGACCGCGATCACCGCTGGAAAAAC 360


4896Ra-3.IR full       361 TACGATCGCGTTTCGAGAGAGCGCAACCATGATGACTTCGATCGGGGATCGGAGCGCAGC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4896Ra-3.in silico     361 TACGATCGCGTTTCGAGAGAGCGCAACCATGATGACTTCGATCGGGGATCGGAGCGCAGC 420


4896Ra-3.IR full       421 AGCCGCAGCAATGACCAGCGGCAGTTCAATAATAATGGAAATAGTAACTCCAGCAGCAGT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4896Ra-3.in silico     421 AGCCGCAGCAATGACCAGCGGCAGTTCAATAATAATGGAAATAGTAACTCCAGCAGCAGT 480


4896Ra-3.IR full       481 TACAGAGATCGCGAGAAGGAGCGCGATCGAGATAGACGGT 520
                           ||||||||||||||||||||||||||||||||||||||||
4896Ra-3.in silico     481 TACAGAGATCGCGAGAAGGAGCGCGATCGAGATAGACGGT 520

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.