National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4887R-2 
 Symbol CG4887  Full Name CG4887 
 CG No CG4887  Old CG No CG4887 
 Synonyms cg4887, CG4887 
 Accession No (Link to NCBI) NM_134738.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACTCGAGTAGTCGGCGCAGTT 
 Primer Seq. 3'
aatctagaggtaccTTCCCTGCTCCGACTTCTGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACTCGAGTAG TCGGCGCAGT TTTTCTGGTG GAAGTGAAAA CGAGGGTGGA CGGGGCAGCG 
0061 ACTACTATAG ATCCAGGCCG GGGTCTCGAT ACAGTCGATC CAGGTCGCGT TCCCGTGANG 
0121 CGCAACCGCA GCCATGGAGG AATCAGGCAC CGGAACTCTC GCTCTCGAAG TCGGGATCGN 
0181 GGATCGGTCG CCCGTGTTCA GAAACGATCA GCATCGCGGT GGTCNGAGGA GGAGCTTGGT 
0241 AACGGGGACC CCGNACCTTT ACCACAGCCT GATCAACGAC GACTACAGGG ATCAGGATGA 
0301 GCGCAACTAC AACTCCAGGA GCAACTTTGA GAATCGTCAG TTCCGGCGAC ATGATAGCTT 
0361 CGACCGTCGG CATCGGGACC GAGATGGCGA GAGCGATCGG GAGCTAAACG ACTACGAGTA 
0421 CGAacANCGC TGCCCGCGAC TTGGACTCAC GTGATCGTAG CTCCACGGAC AGGGACTGGT 
0481 ATCACAACAG AAGTCGGAGC AGGGAA 
 in silico PCR Fragment
0001 ACTCGAGTAG TCGGCGCAGT TTTTCTGGTG GAAGTGAAAA CGAGGGTGGA CGGGGCAGCG 
0061 ACTACTATAG ATCCAGGCCG GGGTCTCGAT ACAGTCGATC CAGGTCGCGT TCCCGTGA-G 
0121 CGCAACCGCA GCCATGGAGG AATCAGGCAC CGGAACTCTC GCTCTCGAAG TCGGGATCG- 
0181 GGATCGGTCG CCCGTGTTCA GAAACGATCA GCATCGCGGT GGTC-GAGGA GGAGC-TGGT 
0241 AACGGGGACC CCG-ACCTTT ACCACAGCCT GATCAACGAC GACTACAGGG ATCAGGATGA 
0301 GCGCAACTAC AACTCCAGGA GCAACTTTGA GAATCGTCAG TTCCGGCGAC ATGATAGCTT 
0361 CGACCGTCGG CATCGGGACC GAGATGGCGA GAGCGATCGG GAGCTAAACG ACTACGAGTA 
0421 CGAACAGCGC T-CCCGCGAC TTGGACTCAC GTGATCGTAG CTCCACGGAC AGGGACTGGT 
0481 ATCACAACAG AAGTCGGAGC AGGGAA 
 Assemble Data

4887R-2.IR_full       1   ACTCGAGTAGTCGGCGCAGTTTTTCTGGTGGAAGTGAAAACGAGGGTGGACGGGGCAGCG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4887R-2.in silico     1   ACTCGAGTAGTCGGCGCAGTTTTTCTGGTGGAAGTGAAAACGAGGGTGGACGGGGCAGCG 60


4887R-2.IR_full       61  ACTACTATAGATCCAGGCCGGGGTCTCGATACAGTCGATCCAGGTCGCGTTCCCGTGANG 120
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
4887R-2.in silico     61  ACTACTATAGATCCAGGCCGGGGTCTCGATACAGTCGATCCAGGTCGCGTTCCCGTGA-G 120


4887R-2.IR_full       121 CGCAACCGCAGCCATGGAGGAATCAGGCACCGGAACTCTCGCTCTCGAAGTCGGGATCGN 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
4887R-2.in silico     121 CGCAACCGCAGCCATGGAGGAATCAGGCACCGGAACTCTCGCTCTCGAAGTCGGGATCG- 180


4887R-2.IR_full       181 GGATCGGTCGCCCGTGTTCAGAAACGATCAGCATCGCGGTGGTCNGAGGAGGAGCTTGGT 240
                          |||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||
4887R-2.in silico     181 GGATCGGTCGCCCGTGTTCAGAAACGATCAGCATCGCGGTGGTC-GAGGAGGAGC-TGGT 240


4887R-2.IR_full       241 AACGGGGACCCCGNACCTTTACCACAGCCTGATCAACGACGACTACAGGGATCAGGATGA 300
                          ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
4887R-2.in silico     241 AACGGGGACCCCG-ACCTTTACCACAGCCTGATCAACGACGACTACAGGGATCAGGATGA 300


4887R-2.IR_full       301 GCGCAACTACAACTCCAGGAGCAACTTTGAGAATCGTCAGTTCCGGCGACATGATAGCTT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4887R-2.in silico     301 GCGCAACTACAACTCCAGGAGCAACTTTGAGAATCGTCAGTTCCGGCGACATGATAGCTT 360


4887R-2.IR_full       361 CGACCGTCGGCATCGGGACCGAGATGGCGAGAGCGATCGGGAGCTAAACGACTACGAGTA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4887R-2.in silico     361 CGACCGTCGGCATCGGGACCGAGATGGCGAGAGCGATCGGGAGCTAAACGACTACGAGTA 420


4887R-2.IR_full       421 CGAACANCGCTGCCCGCGACTTGGACTCACGTGATCGTAGCTCCACGGACAGGGACTGGT 480
                          |||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||
4887R-2.in silico     421 CGAACAGCGCT-CCCGCGACTTGGACTCACGTGATCGTAGCTCCACGGACAGGGACTGGT 480


4887R-2.IR_full       481 ATCACAACAGAAGTCGGAGCAGGGAA 506
                          ||||||||||||||||||||||||||
4887R-2.in silico     481 ATCACAACAGAAGTCGGAGCAGGGAA 506

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134738.2  CG4887-RA (CG4887), mRNA 
0   NR_001305.1  CG4887-RA (CG4887), mRNA, mRNA 
0   NM_139464.2  CG32306-RB, transcript variant B (CG32306), mRNA 
0   NM_206242.1  CG32306-RD, transcript variant D (CG32306), mRNA 
0   NM_168949.1  CG6395-RB, transcript variant B (Csp), mRNA 
0   NM_079489.2  CG6395-RA, transcript variant A (Csp), mRNA 
0   NM_168950.2  CG6395-RC, transcript variant C (Csp), mRNA 
0   NM_132457.1  CG11122-RA (CG11122), mRNA 
0   10  NM_168571.2  CG32133-RA (CG32133), mRNA 
0   NM_142606.2  CG10889-RA (CG10889), mRNA 
0   NM_079845.2  CG7951-RA (sima), mRNA 
0   NM_140735.1  CG6311-RB (CG6311), mRNA 
0   NM_170278.1  CG31082-RA (CG31082), mRNA 
0   NM_142589.1  CG4468-RA (CG4468), mRNA 
0   NM_137395.1  CG10936-RA, transcript variant A (CG10936), mRNA 
0   NM_166242.1  CG10936-RB, transcript variant B (CG10936), mRNA 
0   NM_168626.1  CG7439-RC, transcript variant C (AGO2), mRNA 
0   NM_140518.1  CG7439-RB, transcript variant B (AGO2), mRNA 
0   NM_141687.1  CG12946-RA, transcript variant A (CG12946), mRNA 
0   NM_001043234.1  CG12946-RB, transcript variant B (CG12946), mRNA 
0   NM_136816.1  CG13214-RA, transcript variant A (CG13214), mRNA 
0   10  NM_140112.1  CG14165-RA (CG14165), mRNA 
0   NM_135156.2  CG13991-RA (CG13991), mRNA 
0   NM_142713.2  CG15503-RA (CheB93a), mRNA 
0   11  NM_206395.2  CG6292-RA, transcript variant A (CycT), mRNA 
0   11  NM_079403.3  CG6292-RB, transcript variant B (CycT), mRNA 
0   NM_137759.3  CG30263-RA (CG30263), mRNA 
0   NM_166173.2  CG6262-RC, transcript variant C (CG6262), mRNA 
0   NM_137279.3  CG6262-RA, transcript variant A (CG6262), mRNA 
0   NM_166172.3  CG6262-RB, transcript variant B (CG6262), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
DM
+- 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
++ 
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.