National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4857R-2 
 Symbol CG4857  Full Name CG4857 
 CG No CG4857  Old CG No CG4857 
 Synonyms EG:EG0007.4, EG:EG0007.12, CG4857 
 Accession No (Link to NCBI) NM_131924.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Lim C, Lee J, Choi C, Kilman VL, Kim J, Park SM, Jang SK, Allada R, Choe J.
The novel gene twenty-four defines a critical translational step in the Drosophila clock.
Nature (2011) 470(7334) 399-403 [ PubMed ID = 21331043 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGCCGTCATCATCGGACACAC 
 Primer Seq. 3'
aatctagaggtaccGTTTGGTCGCGACAGTTCAGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGCCGTCATC ATCGGACACA CCGGCGGATC GTGTGGCATC TGGTGGAGCA GCTGCCAAAC 
0061 TGCCAACGAT CATACCGGAC ACGCCCATCG TCTCGATTGC CGCTGGCACG ATGAGCGAGA 
0121 GCACCACGAC GACCACCGTC ACCAAAACAA CGCCGACGCC GTTCCCACAG GAGCAGCTTA 
0181 TGACCATGAT GTCAGACCAT GTGGCGAAAG GCAAGACGCG CAGCTTGACG AGGCCTNTNG 
0241 GAACCAGGGG GCCAAAGACG AGGACAGCCA AGGAGCGGCA CCAGTGGCTG CCAACCATGT 
0301 AGCCACCAGC GGCAGTAGCA GCAGAGGCAA TGACCCCAAG AAGTCATCAT CCCCTAGTAA 
0361 TAGCCATAGC TCTGGTAACC ACGCAGCCAC GGCAGACGCT GCCAAAGGAT CCGCAGCAGA 
0421 AGCAGCAGCA GGAGATACGT CCTTCTCGCA GGTCTTTGCC ATGCTAAAGG ATTCgCCCAG 
0481 CGCTGAACTG TCGCGACCAA AC 
 in silico PCR Fragment
0001 CGCCGTCATC ATCGGACACA CCGGCGGATC GTGTGGCATC TGGTGGAGCA GCTGCCAAAC 
0061 TGCCAACGAT CATACCGGAC ACGCCCATCG TCTCGATTGC CGCTGGCACG ATGAGCGAGA 
0121 GCACCACGAC GACCACCGTC ACCAAAACAA CGCCGACGCC GTTCCCACAG GAGCAGCTTA 
0181 TGACCATGAT GTCAGACCAT GTGGCG-AAG GC-AGACGCG CAGCTTGACG AGGCCTGTAG 
0241 GAACCAGGGG GCCAAAGACG AGGACAGCCA AGGAGCGGCA CCAGTGGCTG CCAACCATGT 
0301 AGCCACCAGC GGCAGTAGCA GCAGAGGCAA TGACCCCAAG AAGTCATCAT CCCCTAGTAA 
0361 TAGCCATAGC TCTGGTAACC ACGCAGCCAC GGCAGACGCT GCCAAAGGAT CCGCAGCAGA 
0421 AGCAGCAGCA GGAGATACGT CCTTCTCGCA GGTCTTTGCC ATGCTAAAGG ATTCGCCCAG 
0481 CGCTGAACTG TCGCGACCAA AC 
 Assemble Data

4857R-2.IR_full       1   CGCCGTCATCATCGGACACACCGGCGGATCGTGTGGCATCTGGTGGAGCAGCTGCCAAAC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4857R-2.in silico     1   CGCCGTCATCATCGGACACACCGGCGGATCGTGTGGCATCTGGTGGAGCAGCTGCCAAAC 60


4857R-2.IR_full       61  TGCCAACGATCATACCGGACACGCCCATCGTCTCGATTGCCGCTGGCACGATGAGCGAGA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4857R-2.in silico     61  TGCCAACGATCATACCGGACACGCCCATCGTCTCGATTGCCGCTGGCACGATGAGCGAGA 120


4857R-2.IR_full       121 GCACCACGACGACCACCGTCACCAAAACAACGCCGACGCCGTTCCCACAGGAGCAGCTTA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4857R-2.in silico     121 GCACCACGACGACCACCGTCACCAAAACAACGCCGACGCCGTTCCCACAGGAGCAGCTTA 180


4857R-2.IR_full       181 TGACCATGATGTCAGACCATGTGGCGAAAGGCAAGACGCGCAGCTTGACGAGGCCTNTNG 240
                          |||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| | |
4857R-2.in silico     181 TGACCATGATGTCAGACCATGTGGCG-AAGGC-AGACGCGCAGCTTGACGAGGCCTGTAG 240


4857R-2.IR_full       241 GAACCAGGGGGCCAAAGACGAGGACAGCCAAGGAGCGGCACCAGTGGCTGCCAACCATGT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4857R-2.in silico     241 GAACCAGGGGGCCAAAGACGAGGACAGCCAAGGAGCGGCACCAGTGGCTGCCAACCATGT 300


4857R-2.IR_full       301 AGCCACCAGCGGCAGTAGCAGCAGAGGCAATGACCCCAAGAAGTCATCATCCCCTAGTAA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4857R-2.in silico     301 AGCCACCAGCGGCAGTAGCAGCAGAGGCAATGACCCCAAGAAGTCATCATCCCCTAGTAA 360


4857R-2.IR_full       361 TAGCCATAGCTCTGGTAACCACGCAGCCACGGCAGACGCTGCCAAAGGATCCGCAGCAGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4857R-2.in silico     361 TAGCCATAGCTCTGGTAACCACGCAGCCACGGCAGACGCTGCCAAAGGATCCGCAGCAGA 420


4857R-2.IR_full       421 AGCAGCAGCAGGAGATACGTCCTTCTCGCAGGTCTTTGCCATGCTAAAGGATTCGCCCAG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4857R-2.in silico     421 AGCAGCAGCAGGAGATACGTCCTTCTCGCAGGTCTTTGCCATGCTAAAGGATTCGCCCAG 480


4857R-2.IR_full       481 CGCTGAACTGTCGCGACCAAAC 502
                          ||||||||||||||||||||||
4857R-2.in silico     481 CGCTGAACTGTCGCGACCAAAC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  42  NM_131924.2  CG4857-RB (CG4857), mRNA 
0.41   11  25  NM_169987.1  CG31353-RA (CG31353), mRNA 
0.2   14  54  97  NM_144114.3  CG14494-RA (CG14494), mRNA 
0.2   13  34  142  NM_132437.1  CG15207-RA (CG15207), mRNA 
0.2   13  45  NM_168758.2  CG32193-RA (CG32193), mRNA 
0.2   10  25  NM_135606.2  CG17124-RA, transcript variant A (CG17124), mRNA 
0.2   10  25  NM_164942.1  CG17124-RB, transcript variant B (CG17124), mRNA 
0.2   24  NM_142105.1  CG14842-RA (CG14842), mRNA 
0.2   31  NM_138767.2  CG14296-RB, transcript variant B (endoA), mRNA 
0.2   31  NM_169838.1  CG14296-RA, transcript variant A (endoA), mRNA 
0.2   25  NM_142225.2  CG5404-RA (CG5404), mRNA 
0   22  249  770  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0   22  249  770  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
0   22  249  770  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
0   11  62  236  NM_206628.1  CG32767-RB, transcript variant B (CG32767), mRNA 
0   11  62  236  NM_131975.3  CG32767-RA, transcript variant A (CG32767), mRNA 
0   50  125  NM_001038965.1  CG9924-RE, transcript variant E (CG9924), mRNA 
0   24  67  NM_165045.1  CG31847-RA (CG31847), mRNA 
0   84  290  NM_001038734.1  CG16902-RC (Hr4), mRNA 
0   80  316  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
0   80  316  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
0   48  86  NM_144133.1  CG13235-RA (CG13235), mRNA 
0   47  83  NM_136061.1  CG15166-RA (CG15166), mRNA 
0   40  68  NM_176711.2  CG1543-RB (Tbh), mRNA 
0   30  98  NM_141993.2  CG7518-RB, transcript variant B (CG7518), mRNA 
0   30  98  NM_169489.1  CG7518-RA, transcript variant A (CG7518), mRNA 
0   70  187  NM_079218.2  CG10491-RA, transcript variant A (vn), mRNA 
0   70  187  NM_001014565.1  CG10491-RB, transcript variant B (vn), mRNA 
0   39  88  NM_133033.1  CG12672-RA (CG12672), mRNA 
0   29  52  NM_132724.2  CG1810-RA (mRNA-capping-enzyme), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.