National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4838R-3 
 Symbol beat-Ic  Full Name beaten path Ic 
 CG No CG4838  Old CG No CG4838 
 Synonyms beat-C, beat Ic, CT15531, BG:DS00913.1, CG4838, beat-Ic 
 Accession No (Link to NCBI) NM_078856.2 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGACGACTATTCCGGGGGCAA 
 Primer Seq. 3'
aatctagaggtaccCAGCTCAACCACCTCCATTTC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGACGACTAT TCCGGGGGCA AGCACCCGTC ACATGCAAAT GGCCAATCGG TGGAGGACGG 
0061 AAAAGGACGT TGGATCCCAT GGTTCCCAAA GTGGGCGTAG CTGCATCTGC TGGATATCCG 
0121 TGGTACTCCT ACTCATTCTG GTGCCTGATT TTATTGAAGC ACTCAAGGAT GTGTCGGTAA 
0181 TGATACCGCA GGCGGTGNAA ACGTGGCAGC AATGCGCNTA TTCACTTGTA ATTACGATAT 
0241 GGAAAACGAT ACTCTATATT CGGTTAAATG GTATAAGGGC AAGCGTGAGT TTTATCGCTA 
0301 TACGCCCAAG GAGAATCCGG CGATGAAGGT CTTTGCCATG ACAAGTGGTC TCAATGTCGA 
0361 GCGCAACCTT TCGAATCAGA GCCACGTCGT CCTGCAGTCG GTGCCGCTGA ATATTTCGGG 
0421 GAAATTTACA TGCGAAATAT CGGTGGAGGC GCCCACTTTT CAAACGGCCA TGGTGTCCGG 
0481 CGAAATGGAG GTGGTTGAGC TG 
 in silico PCR Fragment
0001 AGACGACTAT TCCGGGGGCA AGCACCCGTC ACATGCAAAT GGCCAATCGG TGGAGGACGG 
0061 AAAAGGACGT TGGATCCCAT GGTTCCCAAA GTGGGCGTAG CTGCATCTGC TGGATATCCG 
0121 TGGTACTCCT ACTCATTCTG GTGCCTGATT TTATTGAAGC ACTCAAGGAT GTGTCGGTAA 
0181 TGATACCGCA GGCGGTG-AA ACGTGGCAGC AATGCGC-TA TTCACTTGTA ATTACGATAT 
0241 GGAAAACGAT ACTCTATATT CGGTTAAATG GTATAAGGGC AAGCGTGAGT TTTATCGCTA 
0301 TACGCCCAAG GAGAATCCGG CGATGAAGGT CTTTGCCATG ACAAGTGGTC TCAATGTCGA 
0361 GCGCAACCTT TCGAATCAGA GCCACGTCGT CCTGCAGTCG GTGCCGCTGA ATATTTCGGG 
0421 GAAATTTACA TGCGAAATAT CGGTGGAGGC GCCCACTTTT CAAACGGCCA TGGTGTCCGG 
0481 CGAAATGGAG GTGGTTGAGC TG 
 Assemble Data

4838R-3.IR_full       1   AGACGACTATTCCGGGGGCAAGCACCCGTCACATGCAAATGGCCAATCGGTGGAGGACGG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4838R-3.in silico     1   AGACGACTATTCCGGGGGCAAGCACCCGTCACATGCAAATGGCCAATCGGTGGAGGACGG 60


4838R-3.IR_full       61  AAAAGGACGTTGGATCCCATGGTTCCCAAAGTGGGCGTAGCTGCATCTGCTGGATATCCG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4838R-3.in silico     61  AAAAGGACGTTGGATCCCATGGTTCCCAAAGTGGGCGTAGCTGCATCTGCTGGATATCCG 120


4838R-3.IR_full       121 TGGTACTCCTACTCATTCTGGTGCCTGATTTTATTGAAGCACTCAAGGATGTGTCGGTAA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4838R-3.in silico     121 TGGTACTCCTACTCATTCTGGTGCCTGATTTTATTGAAGCACTCAAGGATGTGTCGGTAA 180


4838R-3.IR_full       181 TGATACCGCAGGCGGTGNAAACGTGGCAGCAATGCGCNTATTCACTTGTAATTACGATAT 240
                          ||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||
4838R-3.in silico     181 TGATACCGCAGGCGGTG-AAACGTGGCAGCAATGCGC-TATTCACTTGTAATTACGATAT 240


4838R-3.IR_full       241 GGAAAACGATACTCTATATTCGGTTAAATGGTATAAGGGCAAGCGTGAGTTTTATCGCTA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4838R-3.in silico     241 GGAAAACGATACTCTATATTCGGTTAAATGGTATAAGGGCAAGCGTGAGTTTTATCGCTA 300


4838R-3.IR_full       301 TACGCCCAAGGAGAATCCGGCGATGAAGGTCTTTGCCATGACAAGTGGTCTCAATGTCGA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4838R-3.in silico     301 TACGCCCAAGGAGAATCCGGCGATGAAGGTCTTTGCCATGACAAGTGGTCTCAATGTCGA 360


4838R-3.IR_full       361 GCGCAACCTTTCGAATCAGAGCCACGTCGTCCTGCAGTCGGTGCCGCTGAATATTTCGGG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4838R-3.in silico     361 GCGCAACCTTTCGAATCAGAGCCACGTCGTCCTGCAGTCGGTGCCGCTGAATATTTCGGG 420


4838R-3.IR_full       421 GAAATTTACATGCGAAATATCGGTGGAGGCGCCCACTTTTCAAACGGCCATGGTGTCCGG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4838R-3.in silico     421 GAAATTTACATGCGAAATATCGGTGGAGGCGCCCACTTTTCAAACGGCCATGGTGTCCGG 480


4838R-3.IR_full       481 CGAAATGGAGGTGGTTGAGCTG 502
                          ||||||||||||||||||||||
4838R-3.in silico     481 CGAAATGGAGGTGGTTGAGCTG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078856.2  CG4838-RA (beat-Ic), mRNA 
0   10  13  14  NM_078855.2  CG7644-RA (beat-Ib), mRNA 
0   14  NM_058160.3  CG4846-RA (beat-Ia), mRNA 
0   NM_137615.2  CG11048-RA (CG11048), mRNA 
0   NM_143571.2  CG15544-RA (CG15544), mRNA 
0   NM_057597.2  CG10719-RA, transcript variant A (brat), mRNA 
0   NM_134302.1  CG10719-RB, transcript variant B (brat), mRNA 
0   NM_206004.1  CG10719-RC, transcript variant C (brat), mRNA 
0   NM_079113.2  CG4012-RA (gek), mRNA 
0   NM_142177.2  CG6563-RA, transcript variant A (Art3), mRNA 
0   NM_169623.2  CG6563-RB, transcript variant B (Art3), mRNA 
0   NM_001038902.1  CG33993-RA (CG33993), mRNA 
0   NM_170141.1  CG6454-RA, transcript variant A (CG6454), mRNA 
0   NM_142992.1  CG6454-RB, transcript variant B (CG6454), mRNA 
0   NM_166147.1  CG8428-RE, transcript variant E (spin), mRNA 
0   NM_166145.1  CG8428-RA, transcript variant A (spin), mRNA 
0   NM_080084.2  CG8428-RD, transcript variant D (spin), mRNA 
0   NM_166144.1  CG8428-RC, transcript variant C (spin), mRNA 
0   NM_166146.1  CG8428-RB, transcript variant B (spin), mRNA 
0   NM_135593.2  CG7296-RA (CG7296), mRNA 
0   NM_166125.2  CG18255-RA, transcript variant A (Strn-Mlck), mRNA 
0   NM_166126.1  CG18255-RC, transcript variant C (Strn-Mlck), mRNA 
0   NM_166127.1  CG18255-RF, transcript variant F (Strn-Mlck), mRNA 
0   NM_143579.2  CG15548-RA (CG15548), mRNA 
0   NM_078689.2  CG14228-RA (Mer), mRNA 
0   NM_165169.3  CG5996-RB, transcript variant B (trpgamma), mRNA 
0   NM_135958.3  CG5996-RA, transcript variant A (trpgamma), mRNA 
0   NM_139875.3  CG7546-RA, transcript variant A (CG7546), mRNA 
0   NM_168217.2  CG7546-RB, transcript variant B (CG7546), mRNA 
0   NM_079640.2  CG6226-RA (FK506-bp1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.