National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4838R-2 
 Symbol beat-Ic  Full Name beaten path Ic 
 CG No CG4838  Old CG No CG4838 
 Synonyms beat-C, beat Ic, CT15531, BG:DS00913.1, CG4838, beat-Ic 
 Accession No (Link to NCBI) NM_078856.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AGACGACTATTCCGGGGGCAAGCACCCGTCACATGCAAATGGCCAATCGGTGGAGGACGG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AAAAGGACGTTGGATCCCATGGTTCCCAAAGTGGGCGTAGCTGCATCTGCTGGATATCCG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TGGTACTCCTACTCATTCTGGTGCCTGATTTTATTGAAGCACTCAAGGATGTGTCGGTAA 180

                          ||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| silico     181 TGATACCGCAGGCGGTG-AAACGTGGCAGCAATGCGC-TATTCACTTGTAATTACGATAT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GGAAAACGATACTCTATATTCGGTTAAATGGTATAAGGGCAAGCGTGAGTTTTATCGCTA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TACGCCCAAGGAGAATCCGGCGATGAAGGTCTTTGCCATGACAAGTGGTCTCAATGTCGA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GCGCAACCTTTCGAATCAGAGCCACGTCGTCCTGCAGTCGGTGCCGCTGAATATTTCGGG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GAAATTTACATGCGAAATATCGGTGGAGGCGCCCACTTTTCAAACGGCCATGGTGTCCGG 480

4838R-2.IR_full       481 CGAAATGGAGGTGGTTGAGCTG 502
                          |||||||||||||||||||||| silico     481 CGAAATGGAGGTGGTTGAGCTG 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078856.2  CG4838-RA (beat-Ic), mRNA 
0   10  13  14  NM_078855.2  CG7644-RA (beat-Ib), mRNA 
0   14  NM_058160.3  CG4846-RA (beat-Ia), mRNA 
0   NM_137615.2  CG11048-RA (CG11048), mRNA 
0   NM_143571.2  CG15544-RA (CG15544), mRNA 
0   NM_057597.2  CG10719-RA, transcript variant A (brat), mRNA 
0   NM_134302.1  CG10719-RB, transcript variant B (brat), mRNA 
0   NM_206004.1  CG10719-RC, transcript variant C (brat), mRNA 
0   NM_079113.2  CG4012-RA (gek), mRNA 
0   NM_142177.2  CG6563-RA, transcript variant A (Art3), mRNA 
0   NM_169623.2  CG6563-RB, transcript variant B (Art3), mRNA 
0   NM_001038902.1  CG33993-RA (CG33993), mRNA 
0   NM_170141.1  CG6454-RA, transcript variant A (CG6454), mRNA 
0   NM_142992.1  CG6454-RB, transcript variant B (CG6454), mRNA 
0   NM_166147.1  CG8428-RE, transcript variant E (spin), mRNA 
0   NM_166145.1  CG8428-RA, transcript variant A (spin), mRNA 
0   NM_080084.2  CG8428-RD, transcript variant D (spin), mRNA 
0   NM_166144.1  CG8428-RC, transcript variant C (spin), mRNA 
0   NM_166146.1  CG8428-RB, transcript variant B (spin), mRNA 
0   NM_135593.2  CG7296-RA (CG7296), mRNA 
0   NM_166125.2  CG18255-RA, transcript variant A (Strn-Mlck), mRNA 
0   NM_166126.1  CG18255-RC, transcript variant C (Strn-Mlck), mRNA 
0   NM_166127.1  CG18255-RF, transcript variant F (Strn-Mlck), mRNA 
0   NM_143579.2  CG15548-RA (CG15548), mRNA 
0   NM_078689.2  CG14228-RA (Mer), mRNA 
0   NM_165169.3  CG5996-RB, transcript variant B (trpgamma), mRNA 
0   NM_135958.3  CG5996-RA, transcript variant A (trpgamma), mRNA 
0   NM_139875.3  CG7546-RA, transcript variant A (CG7546), mRNA 
0   NM_168217.2  CG7546-RB, transcript variant B (CG7546), mRNA 
0   NM_079640.2  CG6226-RA (FK506-bp1), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.