National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4821R-3 
 Symbol Tequila  Full Name Tequila 
 CG No CG4821  Old CG No CG4821 
 Synonyms CG4948, CG18403, graal, SP72, CG18153, CK00198, anon-EST:ParkEST161, CG4821, BEST:GH18038, BEST:CK00198, Tequila, Teq, teq 
 Accession No (Link to NCBI) NM_140031.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr. Biol. (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGTATTGGTGCCTCCGCCTTTCGACCATAAGTTTTATAGTCCTCAGTCGACAAATCCAAG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CATTAATCGAAATCAATCTGCATCTGGTCCCAACTCCCAAGCGGCAATTAAAGAAGCTCT 120

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || silico     121 TAAGCTTATGCTGCGTCCCTATTTCAATCACAGTGGGAATGCCCAAGAGCAACTTGCTCA 180

                          ||||||||||||||||||||||||||| ||||||||  || ||||| ||||||||| ||| silico     181 ACAGGCTGAATCGGCTATAGTGTCTGTAATTAGTAA--GCCGTCAA-CCACTACCA-CCA 240

                          |||||||||||||||| |||||||||||||||||||||||| |||| ||||||||||||| silico     241 CCACACCAAGGCCAAC-TTCCAAGACACCTAAAACAGACCC-TGAC-TTTGACGCCGAAC 300

                          ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TTATT-AAAGCGGGTGAACAGGAAAGCTTGGATTCCGTTGACGACGACTATGTTTTTCCA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GATGCCAGGGAGACGTCCCGAACCGAGCAGACCCTAGATCCCAGTACCACATACGCCTCG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ACAAACTTTCAACGGAGCACTCGCAGGGCTGAGTTAGATCCTGACACCCTAACCGCAACT 480

                          |||||||||||||||||||||||||||| silico     481 ACAATGAAAACCAATTGGCATGCGCCTG 508

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_168314.1  CG4821-RD, transcript variant D (Tequila), mRNA 
100   482  NM_140031.1  CG4821-RA, transcript variant A (Tequila), mRNA 
100   482  NM_168316.1  CG4821-RB, transcript variant B (Tequila), mRNA 
0.41   16  NM_136593.1  CG8181-RA (CG8181), mRNA 
0   11  39  312  NM_170227.2  CG31439-RA (CG31439), mRNA 
0   NM_078879.2  CG10363-RA (TepIV), mRNA 
0   NM_057907.2  CG4007-RA (Nrk), mRNA 
0   NM_139408.1  CG12023-RA, transcript variant A (GV1), mRNA 
0   NM_130498.1  CG13362-RA (CG13362), mRNA 
0   12  NM_136423.1  CG11101-RA (pwn), mRNA 
0   NM_168120.1  CG10625-RB, transcript variant B (CG10625), mRNA 
0   NM_168119.1  CG10625-RD, transcript variant D (CG10625), mRNA 
0   NM_168121.1  CG10625-RC, transcript variant C (CG10625), mRNA 
0   NM_139713.2  CG10625-RA, transcript variant A (CG10625), mRNA 
0   NM_164582.1  CG3054-RA, transcript variant A (l(2)k05819), mRNA 
0   NM_134985.2  CG3054-RB, transcript variant B (l(2)k05819), mRNA 
0   NM_079496.2  CG14637-RA (abs), mRNA 
0   NM_135589.2  CG17104-RA (CG17104), mRNA 
0   NM_078517.2  CG2175-RA, transcript variant A (dec-1), mRNA 
0   18  NM_137883.1  CG13535-RA (CG13535), mRNA 
0   17  NM_142330.1  CG5225-RA (CG5225), mRNA 
0   12  NM_167438.1  CG9151-RB, transcript variant B (acj6), mRNA 
0   12  NM_001014744.1  CG9151-RC, transcript variant C (acj6), mRNA 
0   12  NM_080137.2  CG9151-RA, transcript variant A (acj6), mRNA 
0   12  NM_001014743.1  CG9151-RD, transcript variant D (acj6), mRNA 
0   15  NM_167212.1  CG32694-RB, transcript variant B (CG32694), mRNA 
0   NM_167193.1  CG32702-RA (CG32702), mRNA 
0   NM_130685.1  CG14420-RA (CG14420), mRNA 
0   NM_166259.1  CG30325-RA (CG30325), mRNA 
0   NM_132357.3  CG1468-RA (CG1468), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.