National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4804R-2 
 Symbol CG4804  Full Name CG4804 
 CG No CG4804  Old CG No CG4804 
 Synonyms CG4804 
 Accession No (Link to NCBI) NM_135497.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| silico     1   TTACCACAGCATAGCAACGAGTTTTGCAGAACAAAATGTAGTTGTATCACCACTACTACT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GGAAGCCACTCTGTCCCTGCTCTTCCTGGGATCGGATGGAGCCACCGCCGAGGAGCTGCA 120

                          |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| silico     121 GAAACAACTGCGACTGAAGCAACG-TTTTGCCAGCAATGCCAAAATGGCCAATTTCTATG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CCGCGGAACTGGGCAATATCACAACAGATGCAGATACCTTCCTGCAGCTGCAGAATCGTT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TGATGCTGTCATCTGAATCTGGAGTGGCCGATGATTTCCAGAAGATTGCACAAACCTATT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TCCATGCCACTGCCGAGTGTGTTGATCTGGAGCAAACGGAGAAACTGCGTCGCCACATCA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GCGAACAGATCCTGGCCAGCGTTGGAGGCGGCAGCTGGAAGGATATTCACGTGGCAGGTG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GTTCGTCAGCCAATACCCTGCTCCTGCTGCTGGCCGCCAATCTGCAGAGCAAGTGGTTCC 480

4804R-2.IR_full       481 TGCCCTTCAGTGCCTACAGAA 501
                          ||||||||||||||||||||| silico     481 TGCCCTTCAGTGCCTACAGAA 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135497.1  CG4804-RA (CG4804), mRNA 
0.2   NM_167985.1  CG14955-RB, transcript variant B (CG14955), mRNA 
0.2   NM_139512.1  CG14955-RA, transcript variant A (CG14955), mRNA 
0   NM_167636.1  CG32543-RA (CG32543), mRNA 
0   NM_165512.1  CG11084-RC, transcript variant C (pk), mRNA 
0   13  NM_143372.1  CG9995-RA (htt), mRNA 
0   10  NM_167346.1  CG4353-RA, transcript variant A (hep), mRNA 
0   NM_140497.2  CG6869-RA (FucTA), mRNA 
0   NM_167347.1  CG4353-RB, transcript variant B (hep), mRNA 
0   NM_142994.3  CG18528-RA (CG18528), mRNA 
0   NM_130462.2  CG6562-RB, transcript variant B (synj), mRNA 
0   NM_166505.1  CG6562-RA, transcript variant A (synj), mRNA 
0   NM_167349.1  CG32645-RB (CG32645), mRNA 
0   NM_136724.1  CG12911-RA (CG12911), mRNA 
0   NM_170379.2  CG31048-RA (CG31048), mRNA 
0   NM_136514.2  CG2297-RA (Obp44a), mRNA 
0   17  NM_079903.2  CG15319-RB (nej), mRNA 
0   10  NM_132567.1  CG15732-RA (CG15732), mRNA 
0   NM_132980.1  CG8915-RA (CG8915), mRNA 
0   20  NM_001014624.1  CG33555-RC, transcript variant C (btsz), mRNA 
0   NM_166442.2  CG30387-RC, transcript variant C (CG30387), mRNA 
0   NM_166441.2  CG30387-RB, transcript variant B (CG30387), mRNA 
0   NM_137730.2  CG30387-RA, transcript variant A (CG30387), mRNA 
0   NM_139973.1  CG6694-RA (CG6694), mRNA 
0   NM_167620.2  CG32547-RA (CG32547), mRNA 
0   NM_170492.1  CG31022-RA (PH4alphaEFB), mRNA 
0   NM_136102.2  CG10689-RA (CG10689), mRNA 
0   NM_134727.2  CG4577-RA (CG4577), mRNA 
0   NM_135756.1  CG5142-RA (CG5142), mRNA 
0   NM_164375.1  CG18497-RC, transcript variant C (spen), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.