National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4804R-1 
 Symbol CG4804  Full Name CG4804 
 CG No CG4804  Old CG No CG4804 
 Synonyms CG4804 
 Accession No (Link to NCBI) NM_135497.1 
 Inserted Chr. lll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Gubb D, Sanz-Parra A, Barcena L, Troxler L, Fullaondo A.
Protease inhibitors and proteolytic signalling cascades in insects.
Biochimie (2010) 92(12) 1749-59 [ PubMed ID = 20850496 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTACCACAGCATAGCAACGAG 
 Primer Seq. 3'
aatctagaggtaccTTCTGTAGGCACTGAAGGGCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTACCACAGC ATAGCAACGA GTTTTGCAGA ACAAAATGTA GTTGTATCAc CNCTACTACT 
0061 GGAAGCCACT CTGTCCCTGC TCTTCCTGGG ATCGGATGGA GCCACCGCCG AGGAGCTGCA 
0121 GAAACAACTG CGACTGAAGC AACGTTTTTG CCAGCAATGC CAAAATGGCC AATTTCTATG 
0181 CCGCGGAACT GGGCAATATC ACAACAGATG CAGATACCTT CCTGCAGCTG CAGAATCGTT 
0241 TGATGCTGTC ATCTGAATCT GGAGTGGCCG ATGATTTCCA GAAGATTGCA CAAACCTATT 
0301 TCCATGCCAC TGCCGAGTGT GTTGATCTGG AGCAAACGGA GAAACTGCGT CGCCACATCA 
0361 GCGAACAGAT CCTGGCCAGC GTTGGAGGCG GCAGCTGGAA GGATATTCAC GTGGCAGGTG 
0421 GTTCGTCAGC CAATACCCTG CTCCTGCTGC TGGCCGCCAA TCTGCAGAGC AAGTGGTTCC 
0481 TGCCCTTCAG TGCCTACAGA A 
 in silico PCR Fragment
0001 TTACCACAGC ATAGCAACGA GTTTTGCAGA ACAAAATGTA GTTGTATCAC CACTACTACT 
0061 GGAAGCCACT CTGTCCCTGC TCTTCCTGGG ATCGGATGGA GCCACCGCCG AGGAGCTGCA 
0121 GAAACAACTG CGACTGAAGC AACG-TTTTG CCAGCAATGC CAAAATGGCC AATTTCTATG 
0181 CCGCGGAACT GGGCAATATC ACAACAGATG CAGATACCTT CCTGCAGCTG CAGAATCGTT 
0241 TGATGCTGTC ATCTGAATCT GGAGTGGCCG ATGATTTCCA GAAGATTGCA CAAACCTATT 
0301 TCCATGCCAC TGCCGAGTGT GTTGATCTGG AGCAAACGGA GAAACTGCGT CGCCACATCA 
0361 GCGAACAGAT CCTGGCCAGC GTTGGAGGCG GCAGCTGGAA GGATATTCAC GTGGCAGGTG 
0421 GTTCGTCAGC CAATACCCTG CTCCTGCTGC TGGCCGCCAA TCTGCAGAGC AAGTGGTTCC 
0481 TGCCCTTCAG TGCCTACAGA A 
 Assemble Data

4804R-1.IR_full       1   TTACCACAGCATAGCAACGAGTTTTGCAGAACAAAATGTAGTTGTATCACCNCTACTACT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
4804R-1.in silico     1   TTACCACAGCATAGCAACGAGTTTTGCAGAACAAAATGTAGTTGTATCACCACTACTACT 60


4804R-1.IR_full       61  GGAAGCCACTCTGTCCCTGCTCTTCCTGGGATCGGATGGAGCCACCGCCGAGGAGCTGCA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4804R-1.in silico     61  GGAAGCCACTCTGTCCCTGCTCTTCCTGGGATCGGATGGAGCCACCGCCGAGGAGCTGCA 120


4804R-1.IR_full       121 GAAACAACTGCGACTGAAGCAACGTTTTTGCCAGCAATGCCAAAATGGCCAATTTCTATG 180
                          |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
4804R-1.in silico     121 GAAACAACTGCGACTGAAGCAACG-TTTTGCCAGCAATGCCAAAATGGCCAATTTCTATG 180


4804R-1.IR_full       181 CCGCGGAACTGGGCAATATCACAACAGATGCAGATACCTTCCTGCAGCTGCAGAATCGTT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4804R-1.in silico     181 CCGCGGAACTGGGCAATATCACAACAGATGCAGATACCTTCCTGCAGCTGCAGAATCGTT 240


4804R-1.IR_full       241 TGATGCTGTCATCTGAATCTGGAGTGGCCGATGATTTCCAGAAGATTGCACAAACCTATT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4804R-1.in silico     241 TGATGCTGTCATCTGAATCTGGAGTGGCCGATGATTTCCAGAAGATTGCACAAACCTATT 300


4804R-1.IR_full       301 TCCATGCCACTGCCGAGTGTGTTGATCTGGAGCAAACGGAGAAACTGCGTCGCCACATCA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4804R-1.in silico     301 TCCATGCCACTGCCGAGTGTGTTGATCTGGAGCAAACGGAGAAACTGCGTCGCCACATCA 360


4804R-1.IR_full       361 GCGAACAGATCCTGGCCAGCGTTGGAGGCGGCAGCTGGAAGGATATTCACGTGGCAGGTG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4804R-1.in silico     361 GCGAACAGATCCTGGCCAGCGTTGGAGGCGGCAGCTGGAAGGATATTCACGTGGCAGGTG 420


4804R-1.IR_full       421 GTTCGTCAGCCAATACCCTGCTCCTGCTGCTGGCCGCCAATCTGCAGAGCAAGTGGTTCC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4804R-1.in silico     421 GTTCGTCAGCCAATACCCTGCTCCTGCTGCTGGCCGCCAATCTGCAGAGCAAGTGGTTCC 480


4804R-1.IR_full       481 TGCCCTTCAGTGCCTACAGAA 501
                          |||||||||||||||||||||
4804R-1.in silico     481 TGCCCTTCAGTGCCTACAGAA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135497.1  CG4804-RA (CG4804), mRNA 
0.2   NM_167985.1  CG14955-RB, transcript variant B (CG14955), mRNA 
0.2   NM_139512.1  CG14955-RA, transcript variant A (CG14955), mRNA 
0   NM_167636.1  CG32543-RA (CG32543), mRNA 
0   NM_165512.1  CG11084-RC, transcript variant C (pk), mRNA 
0   13  NM_143372.1  CG9995-RA (htt), mRNA 
0   10  NM_167346.1  CG4353-RA, transcript variant A (hep), mRNA 
0   NM_140497.2  CG6869-RA (FucTA), mRNA 
0   NM_167347.1  CG4353-RB, transcript variant B (hep), mRNA 
0   NM_142994.3  CG18528-RA (CG18528), mRNA 
0   NM_130462.2  CG6562-RB, transcript variant B (synj), mRNA 
0   NM_166505.1  CG6562-RA, transcript variant A (synj), mRNA 
0   NM_167349.1  CG32645-RB (CG32645), mRNA 
0   NM_136724.1  CG12911-RA (CG12911), mRNA 
0   NM_170379.2  CG31048-RA (CG31048), mRNA 
0   NM_136514.2  CG2297-RA (Obp44a), mRNA 
0   17  NM_079903.2  CG15319-RB (nej), mRNA 
0   10  NM_132567.1  CG15732-RA (CG15732), mRNA 
0   NM_132980.1  CG8915-RA (CG8915), mRNA 
0   20  NM_001014624.1  CG33555-RC, transcript variant C (btsz), mRNA 
0   NM_166442.2  CG30387-RC, transcript variant C (CG30387), mRNA 
0   NM_166441.2  CG30387-RB, transcript variant B (CG30387), mRNA 
0   NM_137730.2  CG30387-RA, transcript variant A (CG30387), mRNA 
0   NM_139973.1  CG6694-RA (CG6694), mRNA 
0   NM_167620.2  CG32547-RA (CG32547), mRNA 
0   NM_170492.1  CG31022-RA (PH4alphaEFB), mRNA 
0   NM_136102.2  CG10689-RA (CG10689), mRNA 
0   NM_134727.2  CG4577-RA (CG4577), mRNA 
0   NM_135756.1  CG5142-RA (CG5142), mRNA 
0   NM_164375.1  CG18497-RC, transcript variant C (spen), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.