National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4799R-3 
 Symbol Pen  Full Name Pendulin 
 CG No CG4799  Old CG No CG4799 
 Synonyms imp alpha2, alpha2, Imp-alpha2, imp-alpha2, Kap-alpha2, oho-31, bs29g06.y1, importin alpha2/pendulin, Kap alpha2, oho31, Dimp-alpha2, 2.1, alpha2A-Kap, OHO31, DPend, Oho31, pen-2, pen, l(2)144/1, l(2)k14401, CG4799, anon-WO0140519.258, Pen, IMPalpha2, Kpna2, Rch1 
 Accession No (Link to NCBI) NM_057693.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GAGTAAGGCGGATTCTAACTCACGACAGGGCTCCTACAAGGCCAACAGCATTAACACGCA 60

                          ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| silico     61  GGACTCACGCATGCGCCGCCATGAGGTGACCAT-CGAGCTGCGCAAGTCCAAAAAGGAGG 120

                          ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| silico     121 ACCAGATGTTCAA-GCGGCGCAACATCAACGACGAGGATCTAACGTCGCCGCTCAAAGAG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CTCAATGGCCAGTCGCCGGTGCAGCTGTCCGTGGACGAGATAGTGGCGGCCATGAACAGC 240

                          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| silico     241 GAGGATCAGGAGCGCCAGTTTCTGGGCATGCAGTCTGCCCGCAAGATGCTCAGTCGGGAG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CGCAATCCACCCATCGACCTGATGATCGGCCATGGTATTGTGCCCATTTGCATACGCTTC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| silico     361 CTGCAGAATACCAACAACTCAATGCTGCAGTTCGAGGCCGCTTGGGCGCT-TACCAACAT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CGCCTCTGGCACATCCGACCAAACGCGCTGCGTTATCGAACACAATGCTGTGCCGCATTT 480

4799R-3.IR_full       481 CGTGGCTCTGCTCCAGTCCAAGT 503
                          ||||||||||||||||||||||| silico     481 CGTGGCTCTGCTCCAGTCCAAGT 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057693.3  CG4799-RA (Pen), mRNA 
0.2   NM_167211.1  CG32694-RD, transcript variant D (CG32694), mRNA 
0.2   NM_167212.1  CG32694-RB, transcript variant B (CG32694), mRNA 
0.2   NM_167209.1  CG32694-RA, transcript variant A (CG32694), mRNA 
0.2   NM_167210.1  CG32694-RC, transcript variant C (CG32694), mRNA 
0   11  17  22  NM_169295.2  CG9423-RA, transcript variant A (Kap-alpha3), mRNA 
0   11  17  22  NM_169296.2  CG9423-RB, transcript variant B (Kap-alpha3), mRNA 
0   11  17  22  NM_176437.1  CG9423-RC, transcript variant C (Kap-alpha3), mRNA 
0   17  NM_079443.1  CG8548-RA (Kap-alpha1), mRNA 
0   NM_136755.2  CG16728-RA (CG16728), mRNA 
0   NM_205944.1  CG33298-RB, transcript variant B (CG33298), mRNA 
0   NM_205943.1  CG33298-RA, transcript variant A (CG33298), mRNA 
0   NM_137568.2  CG9975-RA (CG9975), mRNA 
0   NM_079096.2  CG9889-RA (yellow-d), mRNA 
0   NM_001031943.1  CG4460-RB, transcript variant B (Hsp22), mRNA 
0   NM_001031944.1  CG4460-RA, transcript variant A (Hsp22), mRNA 
0   NM_001031945.1  CG4456-RB, transcript variant B (Hsp67Bb), mRNA 
0   NM_134871.1  CG3131-RA (Duox), mRNA 
0   NM_139969.2  CG7015-RA (Unr), mRNA 
0   NM_206432.1  CG2929-RC, transcript variant C (Pi4KIIalpha), mRNA 
0   NM_169063.2  CG2929-RA, transcript variant A (Pi4KIIalpha), mRNA 
0   NM_169064.1  CG2929-RB, transcript variant B (Pi4KIIalpha), mRNA 
0   NM_143684.2  CG11155-RA, transcript variant A (CG11155), mRNA 
0   NM_166417.1  CG30291-RA (CG30291), mRNA 
0   NM_137527.2  CG15092-RA (CG15092), mRNA 
0   NM_078494.2  CG3201-RA (Mlc-c), mRNA 
0   NM_167149.1  CG2151-RB, transcript variant B (Trxr-1), mRNA 
0   NM_078527.2  CG2151-RA, transcript variant A (Trxr-1), mRNA 
0   NM_167150.1  CG2151-RC, transcript variant C (Trxr-1), mRNA 
0   NM_001042826.1  CG41478-RA (CG41478), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.