National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4799R-1 
 Symbol Pen  Full Name Pendulin 
 CG No CG4799  Old CG No CG4799 
 Synonyms imp alpha2, alpha2, Imp-alpha2, imp-alpha2, Kap-alpha2, oho-31, bs29g06.y1, importin alpha2/pendulin, Kap alpha2, oho31, Dimp-alpha2, 2.1, alpha2A-Kap, OHO31, DPend, Oho31, pen-2, pen, l(2)144/1, l(2)k14401, CG4799, anon-WO0140519.258, Pen, IMPalpha2, Kpna2, Rch1 
 Accession No (Link to NCBI) NM_057693.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Molnar C, Casado M, López-Varea A, Cruz C, de Celis JF.
Genetic annotation of gain-of-function screens using RNA interference and in situ hybridization of candidate genes in the Drosophila wing.
Genetics (2012) 192(2) 741-52 [ PubMed ID = 22798488 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment balanced with SM6a, Cy 
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAGTAAGGCGGATTCTAACTC 
 Primer Seq. 3'
aatctagaggtaccACTTGGACTGGAGCAGAGCCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GAGTAAGGCG GATTCTAACT CACGACAGGG CTCCTACAAG GCCAACAGCA TTAACACGCA 
0061 GGACTCACGC ATGCGCCGCC ATGAGGTGAC CATNCGAGCT GCGCAAGTCC AAAAAGGAGG 
0121 ACCAGATGTT CAANGCGGCG CAACATCAAC GACGAGGATC TAACGTCGCC GCTCAAAGAG 
0181 CTCAATGGCC AGTCGCCGGT GCAGCTGTCC GTGGACGAGA TAGTGGCGGC CATGAACAGC 
0241 GAGGATCAGG AGCGCCAGTT CCTGGGCATG CAGTCTGCCC GCAAGATGCT CAGTCGGGAA 
0301 CGCAATCCAC CCATCGACCT GATGATCGGC CATGGTATTG TGCCCATTTG CATACGCTTC 
0361 CTGCAGAATA CCAACAACTC AATGCTGCAG TTCGAGGCCG CTTGGGCGCT NTACCAACAT 
0421 CGCCTCTGGC ACATCCGACC AAACGCGCTG CGTTATCGAA CACAATGCTG TGCCGCATTT 
0481 CGTGGCTCTG CTCCAGTCCA AGT 
 in silico PCR Fragment
0001 GAGTAAGGCG GATTCTAACT CACGACAGGG CTCCTACAAG GCCAACAGCA TTAACACGCA 
0061 GGACTCACGC ATGCGCCGCC ATGAGGTGAC CAT-CGAGCT GCGCAAGTCC AAAAAGGAGG 
0121 ACCAGATGTT CAA-GCGGCG CAACATCAAC GACGAGGATC TAACGTCGCC GCTCAAAGAG 
0181 CTCAATGGCC AGTCGCCGGT GCAGCTGTCC GTGGACGAGA TAGTGGCGGC CATGAACAGC 
0241 GAGGATCAGG AGCGCCAGTT TCTGGGCATG CAGTCTGCCC GCAAGATGCT CAGTCGGGAG 
0301 CGCAATCCAC CCATCGACCT GATGATCGGC CATGGTATTG TGCCCATTTG CATACGCTTC 
0361 CTGCAGAATA CCAACAACTC AATGCTGCAG TTCGAGGCCG CTTGGGCGCT -TACCAACAT 
0421 CGCCTCTGGC ACATCCGACC AAACGCGCTG CGTTATCGAA CACAATGCTG TGCCGCATTT 
0481 CGTGGCTCTG CTCCAGTCCA AGT 
 Assemble Data

4799R-1.IR_full       1   GAGTAAGGCGGATTCTAACTCACGACAGGGCTCCTACAAGGCCAACAGCATTAACACGCA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4799R-1.in silico     1   GAGTAAGGCGGATTCTAACTCACGACAGGGCTCCTACAAGGCCAACAGCATTAACACGCA 60


4799R-1.IR_full       61  GGACTCACGCATGCGCCGCCATGAGGTGACCATNCGAGCTGCGCAAGTCCAAAAAGGAGG 120
                          ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
4799R-1.in silico     61  GGACTCACGCATGCGCCGCCATGAGGTGACCAT-CGAGCTGCGCAAGTCCAAAAAGGAGG 120


4799R-1.IR_full       121 ACCAGATGTTCAANGCGGCGCAACATCAACGACGAGGATCTAACGTCGCCGCTCAAAGAG 180
                          ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
4799R-1.in silico     121 ACCAGATGTTCAA-GCGGCGCAACATCAACGACGAGGATCTAACGTCGCCGCTCAAAGAG 180


4799R-1.IR_full       181 CTCAATGGCCAGTCGCCGGTGCAGCTGTCCGTGGACGAGATAGTGGCGGCCATGAACAGC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4799R-1.in silico     181 CTCAATGGCCAGTCGCCGGTGCAGCTGTCCGTGGACGAGATAGTGGCGGCCATGAACAGC 240


4799R-1.IR_full       241 GAGGATCAGGAGCGCCAGTTCCTGGGCATGCAGTCTGCCCGCAAGATGCTCAGTCGGGAA 300
                          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| 
4799R-1.in silico     241 GAGGATCAGGAGCGCCAGTTTCTGGGCATGCAGTCTGCCCGCAAGATGCTCAGTCGGGAG 300


4799R-1.IR_full       301 CGCAATCCACCCATCGACCTGATGATCGGCCATGGTATTGTGCCCATTTGCATACGCTTC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4799R-1.in silico     301 CGCAATCCACCCATCGACCTGATGATCGGCCATGGTATTGTGCCCATTTGCATACGCTTC 360


4799R-1.IR_full       361 CTGCAGAATACCAACAACTCAATGCTGCAGTTCGAGGCCGCTTGGGCGCTNTACCAACAT 420
                          |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
4799R-1.in silico     361 CTGCAGAATACCAACAACTCAATGCTGCAGTTCGAGGCCGCTTGGGCGCT-TACCAACAT 420


4799R-1.IR_full       421 CGCCTCTGGCACATCCGACCAAACGCGCTGCGTTATCGAACACAATGCTGTGCCGCATTT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4799R-1.in silico     421 CGCCTCTGGCACATCCGACCAAACGCGCTGCGTTATCGAACACAATGCTGTGCCGCATTT 480


4799R-1.IR_full       481 CGTGGCTCTGCTCCAGTCCAAGT 503
                          |||||||||||||||||||||||
4799R-1.in silico     481 CGTGGCTCTGCTCCAGTCCAAGT 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057693.3  CG4799-RA (Pen), mRNA 
0.2   NM_167211.1  CG32694-RD, transcript variant D (CG32694), mRNA 
0.2   NM_167212.1  CG32694-RB, transcript variant B (CG32694), mRNA 
0.2   NM_167209.1  CG32694-RA, transcript variant A (CG32694), mRNA 
0.2   NM_167210.1  CG32694-RC, transcript variant C (CG32694), mRNA 
0   11  17  22  NM_169295.2  CG9423-RA, transcript variant A (Kap-alpha3), mRNA 
0   11  17  22  NM_169296.2  CG9423-RB, transcript variant B (Kap-alpha3), mRNA 
0   11  17  22  NM_176437.1  CG9423-RC, transcript variant C (Kap-alpha3), mRNA 
0   17  NM_079443.1  CG8548-RA (Kap-alpha1), mRNA 
0   NM_136755.2  CG16728-RA (CG16728), mRNA 
0   NM_205944.1  CG33298-RB, transcript variant B (CG33298), mRNA 
0   NM_205943.1  CG33298-RA, transcript variant A (CG33298), mRNA 
0   NM_137568.2  CG9975-RA (CG9975), mRNA 
0   NM_079096.2  CG9889-RA (yellow-d), mRNA 
0   NM_001031943.1  CG4460-RB, transcript variant B (Hsp22), mRNA 
0   NM_001031944.1  CG4460-RA, transcript variant A (Hsp22), mRNA 
0   NM_001031945.1  CG4456-RB, transcript variant B (Hsp67Bb), mRNA 
0   NM_134871.1  CG3131-RA (Duox), mRNA 
0   NM_139969.2  CG7015-RA (Unr), mRNA 
0   NM_206432.1  CG2929-RC, transcript variant C (Pi4KIIalpha), mRNA 
0   NM_169063.2  CG2929-RA, transcript variant A (Pi4KIIalpha), mRNA 
0   NM_169064.1  CG2929-RB, transcript variant B (Pi4KIIalpha), mRNA 
0   NM_143684.2  CG11155-RA, transcript variant A (CG11155), mRNA 
0   NM_166417.1  CG30291-RA (CG30291), mRNA 
0   NM_137527.2  CG15092-RA (CG15092), mRNA 
0   NM_078494.2  CG3201-RA (Mlc-c), mRNA 
0   NM_167149.1  CG2151-RB, transcript variant B (Trxr-1), mRNA 
0   NM_078527.2  CG2151-RA, transcript variant A (Trxr-1), mRNA 
0   NM_167150.1  CG2151-RC, transcript variant C (Trxr-1), mRNA 
0   NM_001042826.1  CG41478-RA (CG41478), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
+- 
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.