National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4793R-1 
 Symbol CG4793  Full Name CG4793 
 CG No CG4793  Old CG No CG4793 
 Synonyms SPH208, BG:DS07486.3, CG4793 
 Accession No (Link to NCBI) NM_135929.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACCGAAACGGGAAGACCAATC 
 Primer Seq. 3'
aatctagaggtaccAGTTTTAGCGGTCTAGCGAGG 
 Predicted Fragment Size
494 
 IR fragment full Seq
0001 ACCGAAACGG GAAGACCAAT CATAGATTTT AGAGGACTTA ATAACGGTAA TCAGGGATGT 
0061 GAATCTGGCC AAACCTGCTG CCCGAAAACG GAAATATTAC AATATCCAGT ACAGGCTGAC 
0121 AATCAACCGC TACCTACTGA ATGTGGCCAC GTGAACCGTA TAGGAGTGGG CTTCACCATA 
0181 ACTAACGCGA GAGACATCGC ACAGAAAGGC GAACTGCCAT GGATGGTGGC CCTGCTCGAT 
0241 TCCAGAAGCC GTCTACCGTT AGGCGGCGGC TCCCTAATTA CGCGGGATGT GGTGCTTACA 
0301 TCATCTACGA AAACTTTGGA AGTTCCTGAG AAATATCTTA TTGTGAGGGC TGGCGAATGG 
0361 GACTTTGAAA GCATCACCGA GGAGCGAGCA CATGAGGACG TTGCGATCAG GAAGATCGTA 
0421 CGACATACCA ATCTCAGTGT CGAAAATGGT GCCAATAATG CGGCCCTTCT GTTCCNTCGC 
0481 TAGACCGCTA AAACT 
 in silico PCR Fragment
0001 ACCGAAACGG GAAGACCAAT CATAGATTTT AGAGGACTTA ATAACGGTAA TCAGGGATGT 
0061 GAATCTGGCC AAACCTGCTG CCCGAAAACG GAAATATTAC AATATCCAGT ACAGGCTGAC 
0121 AATCAACCGC TACCTACTGA ATGTGGCCAC GTGAACCGTA TAGGAGTGGG CTTCACCATA 
0181 ACTAACGCGA GAGACATCGC ACAGAAAGGC GAACTGCCAT GGATGGTGGC CCTGCTCGAT 
0241 TCCAGAAGCC GTCTACCGTT AGGCGGCGGC TCCCTAATTA CGCGGGATGT GGTGCTTACA 
0301 TCATCTACGA AAACTTTGGA AGTTCCTGAG AAATATCTTA TTGTGAGGGC TGGCGAATGG 
0361 GACTTTGAAA GCATCACCGA GGAGCGAGCA CATGAGGACG TTGCGATCAG GAAGATCGTA 
0421 CGACATACCA ATCTCAGTGT CGAAAATGGT GCCAATAATG CGGCCCTTCT GTTCC-TCGC 
0481 TAGACCGCTA AAACT 
 Assemble Data

4793R-1.IR_full       1   ACCGAAACGGGAAGACCAATCATAGATTTTAGAGGACTTAATAACGGTAATCAGGGATGT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4793R-1.in silico     1   ACCGAAACGGGAAGACCAATCATAGATTTTAGAGGACTTAATAACGGTAATCAGGGATGT 60


4793R-1.IR_full       61  GAATCTGGCCAAACCTGCTGCCCGAAAACGGAAATATTACAATATCCAGTACAGGCTGAC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4793R-1.in silico     61  GAATCTGGCCAAACCTGCTGCCCGAAAACGGAAATATTACAATATCCAGTACAGGCTGAC 120


4793R-1.IR_full       121 AATCAACCGCTACCTACTGAATGTGGCCACGTGAACCGTATAGGAGTGGGCTTCACCATA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4793R-1.in silico     121 AATCAACCGCTACCTACTGAATGTGGCCACGTGAACCGTATAGGAGTGGGCTTCACCATA 180


4793R-1.IR_full       181 ACTAACGCGAGAGACATCGCACAGAAAGGCGAACTGCCATGGATGGTGGCCCTGCTCGAT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4793R-1.in silico     181 ACTAACGCGAGAGACATCGCACAGAAAGGCGAACTGCCATGGATGGTGGCCCTGCTCGAT 240


4793R-1.IR_full       241 TCCAGAAGCCGTCTACCGTTAGGCGGCGGCTCCCTAATTACGCGGGATGTGGTGCTTACA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4793R-1.in silico     241 TCCAGAAGCCGTCTACCGTTAGGCGGCGGCTCCCTAATTACGCGGGATGTGGTGCTTACA 300


4793R-1.IR_full       301 TCATCTACGAAAACTTTGGAAGTTCCTGAGAAATATCTTATTGTGAGGGCTGGCGAATGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4793R-1.in silico     301 TCATCTACGAAAACTTTGGAAGTTCCTGAGAAATATCTTATTGTGAGGGCTGGCGAATGG 360


4793R-1.IR_full       361 GACTTTGAAAGCATCACCGAGGAGCGAGCACATGAGGACGTTGCGATCAGGAAGATCGTA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4793R-1.in silico     361 GACTTTGAAAGCATCACCGAGGAGCGAGCACATGAGGACGTTGCGATCAGGAAGATCGTA 420


4793R-1.IR_full       421 CGACATACCAATCTCAGTGTCGAAAATGGTGCCAATAATGCGGCCCTTCTGTTCCNTCGC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
4793R-1.in silico     421 CGACATACCAATCTCAGTGTCGAAAATGGTGCCAATAATGCGGCCCTTCTGTTCC-TCGC 480


4793R-1.IR_full       481 TAGACCGCTAAAACT 495
                          |||||||||||||||
4793R-1.in silico     481 TAGACCGCTAAAACT 495

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   476  NM_135929.2  CG4793-RB, transcript variant B (CG4793), mRNA 
100   476  NM_165139.1  CG4793-RC, transcript variant C (CG4793), mRNA 
0   NM_143214.1  CG6154-RA, transcript variant A (CG6154), mRNA 
0   NM_170267.1  CG6154-RB, transcript variant B (CG6154), mRNA 
0   NM_135530.2  CG5390-RA (CG5390), mRNA 
0   26  23  NM_165119.1  CG31780-RB (CG31780), mRNA 
0   26  23  NM_135919.1  CG18477-RA (CG18477), mRNA 
0   NM_057603.4  CG9852-RA (140up), mRNA 
0   NM_001031967.1  CG7749-RB, transcript variant B (fat2), mRNA 
0   NM_140914.2  CG7749-RA, transcript variant A (fat2), mRNA 
0   NM_001043082.1  CG11798-RC, transcript variant C (chn), mRNA 
0   NM_206119.1  CG11798-RB, transcript variant B (chn), mRNA 
0   NM_137169.3  CG11798-RA, transcript variant A (chn), mRNA 
0   NM_057393.3  CG3158-RA (spn-E), mRNA 
0   NM_140174.4  CG7839-RA (CG7839), mRNA 
0   NM_140748.1  CG6034-RA (CG6034), mRNA 
0   NM_176447.1  CG33208-RF, transcript variant F (MICAL), mRNA 
0   NM_133155.2  CG12200-RA (CG12200), mRNA 
0   NM_176445.1  CG33208-RC, transcript variant C (MICAL), mRNA 
0   NM_132831.1  CG8184-RB (CG8184), mRNA 
0   NM_176449.1  CG33208-RH, transcript variant H (MICAL), mRNA 
0   NM_176448.1  CG33208-RG, transcript variant G (MICAL), mRNA 
0   NM_176446.1  CG33208-RD, transcript variant D (MICAL), mRNA 
0   NM_140875.2  CG9372-RA (CG9372), mRNA 
0   NM_168573.1  CG6603-RB, transcript variant B (Hsc70Cb), mRNA 
0   NM_168082.1  CG32240-RA (CG32240), mRNA 
0   NM_168574.1  CG6603-RC, transcript variant C (Hsc70Cb), mRNA 
0   NM_001014671.1  CG6354-RI, transcript variant I (Rb97D), mRNA 
0   NM_001014675.1  CG6354-RE, transcript variant E (Rb97D), mRNA 
0   NM_001014676.1  CG6354-RD, transcript variant D (Rb97D), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.