National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4791R-1 
 Symbol CG33301  Full Name CG33301 
 CG No CG33301  Old CG No CG4791 
 Synonyms CG4791, CG33301 
 Accession No (Link to NCBI) NM_205955.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGCTAACCGCGGCGTATTTG 
 Primer Seq. 3'
aatctagaggtaccCGTTCCTGCAGAACTATGGAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGGCTAACCG CGGCGTATTT GCAGCCCAGA CTAAGGGCAT ACTGCCAGGA TGACCGGCTG 
0061 CAGGTCCTTA GAATCTGGGC CAAGCCANCG ACGGGGAAAG GAGAGAACTT TGTTGGCGTG 
0121 ATGAcCCGCA TCTATGTGGA CTATCAGCTG GGCGATGGAT CGGTTGTGAA TAAGACCTAC 
0181 ATAGTGAAAC AGGCTCTGTC CGCCGAAGTT NCCCCAGGCG GAGGTCTTCT TCGAATATGA 
0241 GCTGTACACC CGTGAAATGG ACATGTACGA GTTCATTCTG CCCAAGTTGA AGGAACTGCT 
0301 GCAAGAAGCT GGGCTGGACC AAAAACTAAC TGCAGATGCC ATCACCGTGG ACCGCGAGTA 
0361 CAACACCATG ATTCTGGAGG ATTTGGCACC GTACAAGTTC GTCAATNNGG ATCGCGTGAA 
0421 GCAGCTGGAC ATGGCACACA CCGAGCTGAC ACTGGAAATG CTGGCCAAAT TCCATGCCGC 
0481 CTCCATAGTT CTGCAGGAAC G 
 in silico PCR Fragment
0001 TGGCTAACCG CGGCGTATTT GCAGCCCAGA CTAAGGGCAT ACTGCCAGGA TGACCGGCTG 
0061 CAGGTCCTTA GAATCTGGGC CAAGCCAGCG ACGGGGAAAG GAGAGAACTT TGTTGGCGTG 
0121 ATGACCCGCA TCTATGTGGA CTATCAGCTG GGCGATGGAT CGGTTGTGAA TAAGACCTAC 
0181 ATAGTGAAAC AGGCTCTGTC CGCCGAAGTT -CCCCAGGCG GAGGTCTTTT TCGAATATGA 
0241 GCTGTACACT CGTGAAATGG ACATGTACGA GTTCATTCTG CCCAAGTTGA AGGAACTGCT 
0301 GCAAGAAGCT GGGCTGGACC AAAAACTAAC TGCAGATGCC ATCACCGTGG ACCGCGAGTA 
0361 CAACACCATG ATTCTGGAGG ATTTGGCACC GTACAAGTTC GTCAATGCGG ATCGCGTGAA 
0421 GCAGCTGGAC ATGGCACACA CCGAGCTGAC ACTGGAAATG CTGGCCAAAT TCCATGCCGC 
0481 CTCCATAGTT CTGCAGGAAC G 
 Assemble Data

4791R-1.IR_full       1   TGGCTAACCGCGGCGTATTTGCAGCCCAGACTAAGGGCATACTGCCAGGATGACCGGCTG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4791R-1.in silico     1   TGGCTAACCGCGGCGTATTTGCAGCCCAGACTAAGGGCATACTGCCAGGATGACCGGCTG 60


4791R-1.IR_full       61  CAGGTCCTTAGAATCTGGGCCAAGCCANCGACGGGGAAAGGAGAGAACTTTGTTGGCGTG 120
                          ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
4791R-1.in silico     61  CAGGTCCTTAGAATCTGGGCCAAGCCAGCGACGGGGAAAGGAGAGAACTTTGTTGGCGTG 120


4791R-1.IR_full       121 ATGACCCGCATCTATGTGGACTATCAGCTGGGCGATGGATCGGTTGTGAATAAGACCTAC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4791R-1.in silico     121 ATGACCCGCATCTATGTGGACTATCAGCTGGGCGATGGATCGGTTGTGAATAAGACCTAC 180


4791R-1.IR_full       181 ATAGTGAAACAGGCTCTGTCCGCCGAAGTTNCCCCAGGCGGAGGTCTTCTTCGAATATGA 240
                          |||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||
4791R-1.in silico     181 ATAGTGAAACAGGCTCTGTCCGCCGAAGTT-CCCCAGGCGGAGGTCTTTTTCGAATATGA 240


4791R-1.IR_full       241 GCTGTACACCCGTGAAATGGACATGTACGAGTTCATTCTGCCCAAGTTGAAGGAACTGCT 300
                          ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
4791R-1.in silico     241 GCTGTACACTCGTGAAATGGACATGTACGAGTTCATTCTGCCCAAGTTGAAGGAACTGCT 300


4791R-1.IR_full       301 GCAAGAAGCTGGGCTGGACCAAAAACTAACTGCAGATGCCATCACCGTGGACCGCGAGTA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4791R-1.in silico     301 GCAAGAAGCTGGGCTGGACCAAAAACTAACTGCAGATGCCATCACCGTGGACCGCGAGTA 360


4791R-1.IR_full       361 CAACACCATGATTCTGGAGGATTTGGCACCGTACAAGTTCGTCAATNNGGATCGCGTGAA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||
4791R-1.in silico     361 CAACACCATGATTCTGGAGGATTTGGCACCGTACAAGTTCGTCAATGCGGATCGCGTGAA 420


4791R-1.IR_full       421 GCAGCTGGACATGGCACACACCGAGCTGACACTGGAAATGCTGGCCAAATTCCATGCCGC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4791R-1.in silico     421 GCAGCTGGACATGGCACACACCGAGCTGACACTGGAAATGCTGGCCAAATTCCATGCCGC 480


4791R-1.IR_full       481 CTCCATAGTTCTGCAGGAACG 501
                          |||||||||||||||||||||
4791R-1.in silico     481 CTCCATAGTTCTGCAGGAACG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_205955.3  CG33301-RA (CG33301), mRNA 
0.41   NM_143114.1  CG10514-RA (CG10514), mRNA 
0   10  19  49  NM_137608.2  CG16898-RA (CG16898), mRNA 
0   11  13  NM_143112.1  CG11878-RA (CG11878), mRNA 
0   NM_134800.1  CG12674-RA (CG12674), mRNA 
0   NM_143609.2  CG31002-RA (CG31002), mRNA 
0   NM_057842.2  CG16858-RA (vkg), mRNA 
0   NM_165975.1  CG4712-RA, transcript variant A (CG4712), mRNA 
0   NM_137012.1  CG4712-RB, transcript variant B (CG4712), mRNA 
0   NM_130486.1  CG3176-RA (CG3176), mRNA 
0   NM_166842.1  CG32817-RA (CG32817), mRNA 
0   NM_166790.2  CG32019-RA, transcript variant A (bt), mRNA 
0   NM_205877.1  CG32019-RD, transcript variant D (bt), mRNA 
0   NM_205876.1  CG32019-RC, transcript variant C (bt), mRNA 
0   NM_205875.1  CG32019-RE, transcript variant E (bt), mRNA 
0   NM_139619.1  CG1332-RA (CG1332), mRNA 
0   NM_001014640.1  CG14299-RB, transcript variant B (CG14299), mRNA 
0   NM_142495.1  CG14299-RA, transcript variant A (CG14299), mRNA 
0   NM_167806.1  CG16940-RB, transcript variant B (CG16940), mRNA 
0   NM_167805.1  CG16940-RC, transcript variant C (CG16940), mRNA 
0   NM_138168.2  CG16940-RA, transcript variant A (CG16940), mRNA 
0   NM_134481.1  CG14220-RA (CG14220), mRNA 
0   NM_138070.2  CG3492-RA (CG3492), mRNA 
0   NM_168068.1  CG32252-RA (CG32252), mRNA 
0   NM_166430.1  CG9441-RB, transcript variant B (Pu), mRNA 
0   26  23  NM_143110.2  CG11889-RA, transcript variant A (CG11889), mRNA 
0   26  23  NM_143111.2  CG11891-RA, transcript variant A (CG11891), mRNA 
0   20  31  NM_169129.1  CG31562-RA (CG31562), mRNA 
0   17  11  NM_001032041.1  CG11891-RB, transcript variant B (CG11891), mRNA 
0   14  12  NM_001032040.1  CG11891-RC, transcript variant C (CG11891), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.