National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4778R-4 
 Symbol obst-B  Full Name obstructor-B 
 CG No CG4778  Old CG No CG4778 
 Synonyms CK00178, BcDNA:GH02976, BEST:CK00178, obst-B, CG4778 
 Accession No (Link to NCBI) NM_135495.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGTCGGCTAACGAAATGGCG 
 Primer Seq. 3'
aatctagaggtaccCTGGCTTCTCGTGGCCAAAGT 
 Predicted Fragment Size
499 
 IR fragment full Seq
0001 ATGTCGGCTT AACGAAAATG GCGCTTGTGA AAATCTGCAT ATTTTGCTTT GGCTTTGGCC 
0061 GTGGGTCTGA CCGCAACCAA GGCGCAGGAG TCGAGAAGGC GGTTTCCGTG GCAGTAACAG 
0121 CCAGTTTCGC GTGGGTCCTG GCCATTCCGC CATCGCAGCG CCACCTGCCG CCCCGAAACC 
0181 GTGATCCCGT CCAGGAGGCA TCGGTGGTGC CAAAGAGCAA ACAGACGGCG GCAGAGAAGG 
0241 AGTACGAGCC CACCGAGGAG TGCCCGGAGC CCAATGGCTT CTATCCGGAC AGCAAGCAGT 
0301 GCGAACAAGT ACTACGCCTG CCTGGATGGT GTGCCCACGG AGCGACTGTG CGCCGATGGC 
0361 ATGGTCTTCA ATGACTACTC ACCCATCGAG GAGAAGTGCG ATCTGCCCTA CAACATTGAC 
0421 TGCATGAAAC GGAGCAAGCT ACAAACACCT CAGCCATCGC TTCACTGTCC CCGGAAGAAT 
0481 GGATACTTTG GCCACGAGAA GCCAG 
 in silico PCR Fragment
0001 ATGTCGGC-T AACG-AAATG GCGCTTGTGA AAATCTGCAT A-TTTGCTTT GGCTTTGGCC 
0061 GTGGGTCTGA CCGCAACCAA GGCGCAGGAG TCGAG-AGGC GGTTTCCGTG GCAGTAACAG 
0121 CCAGTTTCGC GTGGGTCCTG GCCA-TCCGC CCTCGCAGCG CCACCTGCCG CCCCGAAACC 
0181 GTGATCCCGT CCAGGAGGCA TCGGTGGTGC CAAAGAGCAA ACAGACGGCG GCGGAGAAGG 
0241 AGTACGAGCC CACCGAGGAG TGCCCGGAGC CCAATGGCTT CTATCCGGAC AGCAAGCAGT 
0301 GCG-ACAAGT ACTACGCCTG CCTGGATGGT GTGCCCACGG AGCGACTGTG CGCCGATGGC 
0361 ATGGTCTTCA ATGACTACTC ACCCATCGAG GAGAAGTGCG ATCTGCCCTA CAACATTGAC 
0421 TGCATGAAGC GGAGCAAGCT ACAAACACCT CAGCCATCGC TTCACTGTCC CCGGAAGAAT 
0481 GGATACTTTG GCCACGAGAA GCCAG 
 Assemble Data

4778R-4.IR_full       1   ATGTCGGCTTAACGAAAATGGCGCTTGTGAAAATCTGCATATTTTGCTTTGGCTTTGGCC 60
                          |||||||| ||||| |||||||||||||||||||||||||| ||||||||||||||||||
4778R-4.in silico     1   ATGTCGGC-TAACG-AAATGGCGCTTGTGAAAATCTGCATA-TTTGCTTTGGCTTTGGCC 60


4778R-4.IR_full       61  GTGGGTCTGACCGCAACCAAGGCGCAGGAGTCGAGAAGGCGGTTTCCGTGGCAGTAACAG 120
                          ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
4778R-4.in silico     61  GTGGGTCTGACCGCAACCAAGGCGCAGGAGTCGAG-AGGCGGTTTCCGTGGCAGTAACAG 120


4778R-4.IR_full       121 CCAGTTTCGCGTGGGTCCTGGCCATTCCGCCATCGCAGCGCCACCTGCCGCCCCGAAACC 180
                          |||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||
4778R-4.in silico     121 CCAGTTTCGCGTGGGTCCTGGCCA-TCCGCCCTCGCAGCGCCACCTGCCGCCCCGAAACC 180


4778R-4.IR_full       181 GTGATCCCGTCCAGGAGGCATCGGTGGTGCCAAAGAGCAAACAGACGGCGGCAGAGAAGG 240
                          |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
4778R-4.in silico     181 GTGATCCCGTCCAGGAGGCATCGGTGGTGCCAAAGAGCAAACAGACGGCGGCGGAGAAGG 240


4778R-4.IR_full       241 AGTACGAGCCCACCGAGGAGTGCCCGGAGCCCAATGGCTTCTATCCGGACAGCAAGCAGT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4778R-4.in silico     241 AGTACGAGCCCACCGAGGAGTGCCCGGAGCCCAATGGCTTCTATCCGGACAGCAAGCAGT 300


4778R-4.IR_full       301 GCGAACAAGTACTACGCCTGCCTGGATGGTGTGCCCACGGAGCGACTGTGCGCCGATGGC 360
                          ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4778R-4.in silico     301 GCG-ACAAGTACTACGCCTGCCTGGATGGTGTGCCCACGGAGCGACTGTGCGCCGATGGC 360


4778R-4.IR_full       361 ATGGTCTTCAATGACTACTCACCCATCGAGGAGAAGTGCGATCTGCCCTACAACATTGAC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4778R-4.in silico     361 ATGGTCTTCAATGACTACTCACCCATCGAGGAGAAGTGCGATCTGCCCTACAACATTGAC 420


4778R-4.IR_full       421 TGCATGAAACGGAGCAAGCTACAAACACCTCAGCCATCGCTTCACTGTCCCCGGAAGAAT 480
                          |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
4778R-4.in silico     421 TGCATGAAGCGGAGCAAGCTACAAACACCTCAGCCATCGCTTCACTGTCCCCGGAAGAAT 480


4778R-4.IR_full       481 GGATACTTTGGCCACGAGAAGCCAG 505
                          |||||||||||||||||||||||||
4778R-4.in silico     481 GGATACTTTGGCCACGAGAAGCCAG 505

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   481  NM_135495.2  CG4778-RA (CG4778), mRNA 
0   10  11  NM_134534.2  CG17052-RA (CG17052), mRNA 
0   NM_138144.2  CG2765-RA (CG2765), mRNA 
0   18  NM_142959.2  CG6129-RB, transcript variant B (CG6129), mRNA 
0   NM_143750.2  CG6133-RA (CG6133), mRNA 
0   NM_166442.2  CG30387-RC, transcript variant C (CG30387), mRNA 
0   NM_166441.2  CG30387-RB, transcript variant B (CG30387), mRNA 
0   NM_137730.2  CG30387-RA, transcript variant A (CG30387), mRNA 
0   NM_058084.3  CG8766-RA, transcript variant A (tafazzin), mRNA 
0   NM_165947.1  CG8766-RB, transcript variant B (tafazzin), mRNA 
0   NM_165948.1  CG8766-RC, transcript variant C (tafazzin), mRNA 
0   NM_135745.1  CG5787-RA (CG5787), mRNA 
0   NM_132962.1  CG8945-RC (CG8945), mRNA 
0   13  NM_176553.1  CG6129-RC, transcript variant C (CG6129), mRNA 
0   NM_139720.2  CG5150-RA (CG5150), mRNA 
0   NM_001043291.1  CG34150-RA (CG34150), mRNA 
0   NM_136991.2  CG3915-RB, transcript variant B (Drl-2), mRNA 
0   13  NM_057894.3  CG5799-RA, transcript variant A (dve), mRNA 
0   NM_135306.2  CG7144-RA (CG7144), mRNA 
0   NM_001042799.1  CG10966-RB, transcript variant B (rdgA), mRNA 
0   NM_078537.2  CG10966-RA, transcript variant A (rdgA), mRNA 
0   NM_136330.1  CG11665-RA (CG11665), mRNA 
0   NM_137773.1  CG13493-RA (comr), mRNA 
0   NM_132991.1  CG12432-RA (CG12432), mRNA 
0   NM_138059.1  CG13575-RA (CG13575), mRNA 
0   NM_136585.1  CG13745-RA (CG13745), mRNA 
0   NM_135371.3  CG7627-RA (CG7627), mRNA 
0   NM_140031.1  CG4821-RA, transcript variant A (Tequila), mRNA 
0   NM_142892.2  CG4370-RA, transcript variant A (Irk2), mRNA 
0   NM_142874.2  CG6747-RA (Ir), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
DC
 
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.