National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4778R-3 
 Symbol obst-B  Full Name obstructor-B 
 CG No CG4778  Old CG No CG4778 
 Synonyms CK00178, BcDNA:GH02976, BEST:CK00178, obst-B, CG4778 
 Accession No (Link to NCBI) NM_135495.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
[Please submit your publication]
Yano H, Yamamoto-Hino M, Awano W, Aoki-Kinoshita KF, Tsuda-Sakurai K, Okano H, Goto S.
Identification of proteasome components required for apical localization of Chaoptin using functional genomics.
J. Neurogenet. (2012) 26(1) 53-63 [ PubMed ID = 22417167 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||| ||||| |||||||||||||||||||||||||| |||||||||||||||||| silico     1   ATGTCGGC-TAACG-AAATGGCGCTTGTGAAAATCTGCATA-TTTGCTTTGGCTTTGGCC 60

                          ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| silico     61  GTGGGTCTGACCGCAACCAAGGCGCAGGAGTCGAG-AGGCGGTTTCCGTGGCAGTAACAG 120

                          |||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| silico     121 CCAGTTTCGCGTGGGTCCTGGCCA-TCCGCCCTCGCAGCGCCACCTGCCGCCCCGAAACC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| silico     181 GTGATCCCGTCCAGGAGGCATCGGTGGTGCCAAAGAGCAAACAGACGGCGGCGGAGAAGG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AGTACGAGCCCACCGAGGAGTGCCCGGAGCCCAATGGCTTCTATCCGGACAGCAAGCAGT 300

                          ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GCG-ACAAGTACTACGCCTGCCTGGATGGTGTGCCCACGGAGCGACTGTGCGCCGATGGC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 ATGGTCTTCAATGACTACTCACCCATCGAGGAGAAGTGCGATCTGCCCTACAACATTGAC 420

                          |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TGCATGAAGCGGAGCAAGCTACAAACACCTCAGCCATCGCTTCACTGTCCCCGGAAGAAT 480

                          ||||||||||||||||||||||||| silico     481 GGATACTTTGGCCACGAGAAGCCAG 505

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   481  NM_135495.2  CG4778-RA (CG4778), mRNA 
0   10  11  NM_134534.2  CG17052-RA (CG17052), mRNA 
0   NM_138144.2  CG2765-RA (CG2765), mRNA 
0   18  NM_142959.2  CG6129-RB, transcript variant B (CG6129), mRNA 
0   NM_143750.2  CG6133-RA (CG6133), mRNA 
0   NM_166442.2  CG30387-RC, transcript variant C (CG30387), mRNA 
0   NM_166441.2  CG30387-RB, transcript variant B (CG30387), mRNA 
0   NM_137730.2  CG30387-RA, transcript variant A (CG30387), mRNA 
0   NM_058084.3  CG8766-RA, transcript variant A (tafazzin), mRNA 
0   NM_165947.1  CG8766-RB, transcript variant B (tafazzin), mRNA 
0   NM_165948.1  CG8766-RC, transcript variant C (tafazzin), mRNA 
0   NM_135745.1  CG5787-RA (CG5787), mRNA 
0   NM_132962.1  CG8945-RC (CG8945), mRNA 
0   13  NM_176553.1  CG6129-RC, transcript variant C (CG6129), mRNA 
0   NM_139720.2  CG5150-RA (CG5150), mRNA 
0   NM_001043291.1  CG34150-RA (CG34150), mRNA 
0   NM_136991.2  CG3915-RB, transcript variant B (Drl-2), mRNA 
0   13  NM_057894.3  CG5799-RA, transcript variant A (dve), mRNA 
0   NM_135306.2  CG7144-RA (CG7144), mRNA 
0   NM_001042799.1  CG10966-RB, transcript variant B (rdgA), mRNA 
0   NM_078537.2  CG10966-RA, transcript variant A (rdgA), mRNA 
0   NM_136330.1  CG11665-RA (CG11665), mRNA 
0   NM_137773.1  CG13493-RA (comr), mRNA 
0   NM_132991.1  CG12432-RA (CG12432), mRNA 
0   NM_138059.1  CG13575-RA (CG13575), mRNA 
0   NM_136585.1  CG13745-RA (CG13745), mRNA 
0   NM_135371.3  CG7627-RA (CG7627), mRNA 
0   NM_140031.1  CG4821-RA, transcript variant A (Tequila), mRNA 
0   NM_142892.2  CG4370-RA, transcript variant A (Irk2), mRNA 
0   NM_142874.2  CG6747-RA (Ir), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.