National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4767R-3 
 Symbol Tektin-A  Full Name Tektin A 
 CG No CG4767  Old CG No CG4767 
 Synonyms CG4767, BG:DS02252.2, anon-WO0140519.235, Tektin-A 
 Accession No (Link to NCBI) NM_078853.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CGCTA-ATCTGTCCCCTGCCGACGGAACCACCCTCCCACCGACTGAAAAAGCCACCGCAG 60

                          |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| silico     61  CCCGCCCTGGTAGCCTTGACACCTCATCCCGATGAGGCCGCCCAACAGCACCTGGTCCAA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AATATTATGGGTTCTGCCCAAGAGCATCAGAAGCTACAGGCGGATCTCCAAGCGGGAGTT 180

                          |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| silico     181 GACCAACAGCAGATGCAATTGGCCGATATGCGAGCTGAACAGTACAAGCAATCGAACAAG 240

                          ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| silico     241 CCACTCAGAATGGAGGAAGTGCAGTTTGCGCGTTCCATGGACCCCGAAGCAGATGACTTG 300

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| silico     301 CGGAATCCACCGTGCTACTTGCCCCAACAGGGCGATGAGTTGCCTCACAAGGACC-AGCT 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GATGCCCATGGGTCCGATTGGTCCATGGGCATCGGGCAAGGTGGATTGGAGCCCCATGGC 420

                          |||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| silico     421 CGGCATAACGGGAACGAGACCCGTTGTGGACCGCTACTCGATCACCCGGTACAGCCCAAA 480

4767R-3.IR_full       481 TGAATGGCGGACCAGGANACCAC 503
                          ||||||||||||||||| ||||| silico     481 TGAATGGCGGACCAGGA-ACCAC 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078853.2  CG4767-RA (Tektin-A), mRNA 
0   NM_169228.1  CG31258-RA (CG31258), mRNA 
0   NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_001032052.1  CG33715-RE, transcript variant E (Msp-300), mRNA 
0   NM_001032053.1  CG33715-RB, transcript variant B (Msp-300), mRNA 
0   NM_057894.3  CG5799-RA, transcript variant A (dve), mRNA 
0   NM_057893.3  CG5799-RB, transcript variant B (dve), mRNA 
0   NM_167408.1  CG32600-RA (dpr8), mRNA 
0   NM_165413.1  CG17018-RA, transcript variant A (CG17018), mRNA 
0   NM_165415.1  CG17018-RD, transcript variant D (CG17018), mRNA 
0   NM_165414.1  CG17018-RC, transcript variant C (CG17018), mRNA 
0   NM_132546.2  CG1492-RA (CG1492), mRNA 
0   NM_167395.1  CG32597-RA (l(1)G0469), mRNA 
0   NM_140523.2  CG7764-RA (Tfb2), mRNA 
0   NM_132607.1  CG4661-RA (CG4661), mRNA 
0   NM_170040.2  CG31139-RA (CG31139), mRNA 
0   13  NM_140468.2  CG9425-RA, transcript variant A (CG9425), mRNA 
0   13  NM_206362.1  CG9425-RB, transcript variant B (CG9425), mRNA 
0   NM_140079.1  CG3280-RA (CG3280), mRNA 
0   NM_078891.2  CG1374-RA, transcript variant A (tsh), mRNA 
0   NM_206021.1  CG1374-RB, transcript variant B (tsh), mRNA 
0   NM_206144.1  CG15609-RB, transcript variant B (CG15609), mRNA 
0   NM_206143.1  CG15609-RC, transcript variant C (CG15609), mRNA 
0   NM_137335.2  CG15609-RA, transcript variant A (CG15609), mRNA 
0   11  NM_134517.2  CG15618-RA (CG15618), mRNA 
0   NM_141731.1  CG3996-RA (CG3996), mRNA 
0   NM_167852.1  CG9097-RB, transcript variant B (bab1), mRNA 
0   NM_058149.3  CG3352-RA (ft), mRNA 
0   NM_142297.2  CG14900-RA (Cad89D), mRNA 
0   NM_139680.1  CG17150-RA, transcript variant A (CG17150), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.