National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4767R-1 
 Symbol Tektin-A  Full Name Tektin A 
 CG No CG4767  Old CG No CG4767 
 Synonyms CG4767, BG:DS02252.2, anon-WO0140519.235, Tektin-A 
 Accession No (Link to NCBI) NM_078853.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGCTAATCTGTCCCCTGCCGA 
 Primer Seq. 3'
aatctagaggtaccGTGGTTCCTGGTCCGCCATTC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 cGCTATATCT GTCCCCTGCC GACGGAACCA CCCTCCCACC GACTGAAAAA GCCACCGCAG 
0061 CCCGCCCTGG TAGCCTTGAC ACCTCATCCC GATGAGNCCG CCCAACAGCA CCTGGTCCAA 
0121 AATATTATGG GTTCTGCCCA AGAGCATCAG AAGCTACAGG CGGATCTCCA AGCGGGAGTT 
0181 GACCAACAGC AGATGCAATT GGCCGATATG CGAGCTGAAC AGTACATGCA ATCGAACAAG 
0241 CCACTCAGAA TGGAGGAAGT GCAGTTTGCG CGTTCCATGG ATCCCGAAGC AGATGACTTG 
0301 CGGAATCCAC CGTGCTACTT GCCCCAACAG GGCGATGAGT TGCCTCACAA GGACCGAGCT 
0361 GATGCCCATG GGTCCGATTG GTCCATGGGC ATCGGGCAAG GTGGATTGGA gCCCCATGGC 
0421 CGGCATAACG GGAACGAGNC CCGTTGTGGA CCGNTACTCG ATCACCCGGT ACAGCCCAAA 
0481 TGAATGGCGG ACCAGGANAC CAc 
 in silico PCR Fragment
0001 CGCTA-ATCT GTCCCCTGCC GACGGAACCA CCCTCCCACC GACTGAAAAA GCCACCGCAG 
0061 CCCGCCCTGG TAGCCTTGAC ACCTCATCCC GATGAGGCCG CCCAACAGCA CCTGGTCCAA 
0121 AATATTATGG GTTCTGCCCA AGAGCATCAG AAGCTACAGG CGGATCTCCA AGCGGGAGTT 
0181 GACCAACAGC AGATGCAATT GGCCGATATG CGAGCTGAAC AGTACAAGCA ATCGAACAAG 
0241 CCACTCAGAA TGGAGGAAGT GCAGTTTGCG CGTTCCATGG ACCCCGAAGC AGATGACTTG 
0301 CGGAATCCAC CGTGCTACTT GCCCCAACAG GGCGATGAGT TGCCTCACAA GGACC-AGCT 
0361 GATGCCCATG GGTCCGATTG GTCCATGGGC ATCGGGCAAG GTGGATTGGA GCCCCATGGC 
0421 CGGCATAACG GGAACGAGAC CCGTTGTGGA CCGCTACTCG ATCACCCGGT ACAGCCCAAA 
0481 TGAATGGCGG ACCAGGA-AC CAC 
 Assemble Data

4767R-1.IR_full       1   CGCTATATCTGTCCCCTGCCGACGGAACCACCCTCCCACCGACTGAAAAAGCCACCGCAG 60
                          ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
4767R-1.in silico     1   CGCTA-ATCTGTCCCCTGCCGACGGAACCACCCTCCCACCGACTGAAAAAGCCACCGCAG 60


4767R-1.IR_full       61  CCCGCCCTGGTAGCCTTGACACCTCATCCCGATGAGNCCGCCCAACAGCACCTGGTCCAA 120
                          |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
4767R-1.in silico     61  CCCGCCCTGGTAGCCTTGACACCTCATCCCGATGAGGCCGCCCAACAGCACCTGGTCCAA 120


4767R-1.IR_full       121 AATATTATGGGTTCTGCCCAAGAGCATCAGAAGCTACAGGCGGATCTCCAAGCGGGAGTT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4767R-1.in silico     121 AATATTATGGGTTCTGCCCAAGAGCATCAGAAGCTACAGGCGGATCTCCAAGCGGGAGTT 180


4767R-1.IR_full       181 GACCAACAGCAGATGCAATTGGCCGATATGCGAGCTGAACAGTACATGCAATCGAACAAG 240
                          |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
4767R-1.in silico     181 GACCAACAGCAGATGCAATTGGCCGATATGCGAGCTGAACAGTACAAGCAATCGAACAAG 240


4767R-1.IR_full       241 CCACTCAGAATGGAGGAAGTGCAGTTTGCGCGTTCCATGGATCCCGAAGCAGATGACTTG 300
                          ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
4767R-1.in silico     241 CCACTCAGAATGGAGGAAGTGCAGTTTGCGCGTTCCATGGACCCCGAAGCAGATGACTTG 300


4767R-1.IR_full       301 CGGAATCCACCGTGCTACTTGCCCCAACAGGGCGATGAGTTGCCTCACAAGGACCGAGCT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
4767R-1.in silico     301 CGGAATCCACCGTGCTACTTGCCCCAACAGGGCGATGAGTTGCCTCACAAGGACC-AGCT 360


4767R-1.IR_full       361 GATGCCCATGGGTCCGATTGGTCCATGGGCATCGGGCAAGGTGGATTGGAGCCCCATGGC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4767R-1.in silico     361 GATGCCCATGGGTCCGATTGGTCCATGGGCATCGGGCAAGGTGGATTGGAGCCCCATGGC 420


4767R-1.IR_full       421 CGGCATAACGGGAACGAGNCCCGTTGTGGACCGNTACTCGATCACCCGGTACAGCCCAAA 480
                          |||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||
4767R-1.in silico     421 CGGCATAACGGGAACGAGACCCGTTGTGGACCGCTACTCGATCACCCGGTACAGCCCAAA 480


4767R-1.IR_full       481 TGAATGGCGGACCAGGANACCAC 503
                          ||||||||||||||||| |||||
4767R-1.in silico     481 TGAATGGCGGACCAGGA-ACCAC 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078853.2  CG4767-RA (Tektin-A), mRNA 
0   NM_169228.1  CG31258-RA (CG31258), mRNA 
0   NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_001032052.1  CG33715-RE, transcript variant E (Msp-300), mRNA 
0   NM_001032053.1  CG33715-RB, transcript variant B (Msp-300), mRNA 
0   NM_057894.3  CG5799-RA, transcript variant A (dve), mRNA 
0   NM_057893.3  CG5799-RB, transcript variant B (dve), mRNA 
0   NM_167408.1  CG32600-RA (dpr8), mRNA 
0   NM_165413.1  CG17018-RA, transcript variant A (CG17018), mRNA 
0   NM_165415.1  CG17018-RD, transcript variant D (CG17018), mRNA 
0   NM_165414.1  CG17018-RC, transcript variant C (CG17018), mRNA 
0   NM_132546.2  CG1492-RA (CG1492), mRNA 
0   NM_167395.1  CG32597-RA (l(1)G0469), mRNA 
0   NM_140523.2  CG7764-RA (Tfb2), mRNA 
0   NM_132607.1  CG4661-RA (CG4661), mRNA 
0   NM_170040.2  CG31139-RA (CG31139), mRNA 
0   13  NM_140468.2  CG9425-RA, transcript variant A (CG9425), mRNA 
0   13  NM_206362.1  CG9425-RB, transcript variant B (CG9425), mRNA 
0   NM_140079.1  CG3280-RA (CG3280), mRNA 
0   NM_078891.2  CG1374-RA, transcript variant A (tsh), mRNA 
0   NM_206021.1  CG1374-RB, transcript variant B (tsh), mRNA 
0   NM_206144.1  CG15609-RB, transcript variant B (CG15609), mRNA 
0   NM_206143.1  CG15609-RC, transcript variant C (CG15609), mRNA 
0   NM_137335.2  CG15609-RA, transcript variant A (CG15609), mRNA 
0   11  NM_134517.2  CG15618-RA (CG15618), mRNA 
0   NM_141731.1  CG3996-RA (CG3996), mRNA 
0   NM_167852.1  CG9097-RB, transcript variant B (bab1), mRNA 
0   NM_058149.3  CG3352-RA (ft), mRNA 
0   NM_142297.2  CG14900-RA (Cad89D), mRNA 
0   NM_139680.1  CG17150-RA, transcript variant A (CG17150), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.