National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4734R-1 
 Symbol CG4734  Full Name CG4734 
 CG No CG4734  Old CG No CG4734 
 Synonyms CG4734 
 Accession No (Link to NCBI) NM_137020.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAGGTGTGGCAGCACATCTAT 
 Primer Seq. 3'
aatctagaggtaccTGTGGCACCATCAGAAAATCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GAGGTGTGGC AGCACATCTA TGTGCCCTTC AACGCCACCG ATGGTGAGTC TCTGGTGGAT 
0061 CTGGTCATCA GTTTGGCCGA TCGTGCTGGA GCCAGTGGCT TGCCCACCGC CTACTGGGAC 
0121 ATGACCGTCA CGCAGCTGGA GTGCCCGGCC GGAGCATCCG TTCGCTCGTT GGACCTGGAG 
0181 GACGATGTCA CCATTGAGAG TCGTGCCAGC ACCATCAAGG ATGGCTTCTT TGTTGCCCCG 
0241 CCCGGCTGTC GGCAGTACTT CCCCGAGGCC AAGGGAGCTG TGAAGTCCTT CAACTACAAC 
0301 GATGGCGATG GCATCTATCC ATCTCGCATG AACTACGCCA TCTGCTTCCG TCGCCAAACC 
0361 GATACTAAGA CTCTAACCAT TCGCGCCTAT GACTTCAACG TGGGAGATGT GGTTTCCGCT 
0421 TCCACCTTGA TGACCGATGA GAACTGCTAC AGCAGCGATA GTACCAACGA TCTGGATGCC 
0481 GATTTTCTGA TGGTGCCACA  
 in silico PCR Fragment
0001 GAGGTGTGGC AGCACATCTA TGTGCCCTTC AACGCCACCG ATGGTGAGTC TCTGGTGGAT 
0061 CTGGTCATCA GTTTGGCCGA TCGTGCTGGA GCCAGTGGCT TGCCCACCGC CTACTGGGAC 
0121 ATGACCGTCA CGCAGCTGGA GTGCCCGGCC GGAGCATCCG TTCGCTCGTT GGACCTGGAG 
0181 GACGATGTCA CCATTGAGAG TCGTGCCAGC ACCATCAAGG ATGGCTTCTT TGTTGCCCCG 
0241 CCCGGCTGTC GGCAGTACTT CCCCGAGGCC AAGGGAGCTG TGAAGTCCTT CAACTACAAC 
0301 GATGGCGATG GCATCTATCC ATCTCGCATG AACTACGCCA TCTGCTTCCG TCGCCAAACC 
0361 GATACTAAGA CTCTAACCAT TCGCGCCTAT GACTTCAACG TGGGAGATGT GGTTTCCGCT 
0421 TCCACCTTGA TGACCGATGA GAACTGCTAC AGCAGCGATA GTACCAACGA TCTGGATGCC 
0481 GATTTTCTGA TGGTGCCACA  
 Assemble Data

4734R-1.IR_full       1   GAGGTGTGGCAGCACATCTATGTGCCCTTCAACGCCACCGATGGTGAGTCTCTGGTGGAT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4734R-1.in silico     1   GAGGTGTGGCAGCACATCTATGTGCCCTTCAACGCCACCGATGGTGAGTCTCTGGTGGAT 60


4734R-1.IR_full       61  CTGGTCATCAGTTTGGCCGATCGTGCTGGAGCCAGTGGCTTGCCCACCGCCTACTGGGAC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4734R-1.in silico     61  CTGGTCATCAGTTTGGCCGATCGTGCTGGAGCCAGTGGCTTGCCCACCGCCTACTGGGAC 120


4734R-1.IR_full       121 ATGACCGTCACGCAGCTGGAGTGCCCGGCCGGAGCATCCGTTCGCTCGTTGGACCTGGAG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4734R-1.in silico     121 ATGACCGTCACGCAGCTGGAGTGCCCGGCCGGAGCATCCGTTCGCTCGTTGGACCTGGAG 180


4734R-1.IR_full       181 GACGATGTCACCATTGAGAGTCGTGCCAGCACCATCAAGGATGGCTTCTTTGTTGCCCCG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4734R-1.in silico     181 GACGATGTCACCATTGAGAGTCGTGCCAGCACCATCAAGGATGGCTTCTTTGTTGCCCCG 240


4734R-1.IR_full       241 CCCGGCTGTCGGCAGTACTTCCCCGAGGCCAAGGGAGCTGTGAAGTCCTTCAACTACAAC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4734R-1.in silico     241 CCCGGCTGTCGGCAGTACTTCCCCGAGGCCAAGGGAGCTGTGAAGTCCTTCAACTACAAC 300


4734R-1.IR_full       301 GATGGCGATGGCATCTATCCATCTCGCATGAACTACGCCATCTGCTTCCGTCGCCAAACC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4734R-1.in silico     301 GATGGCGATGGCATCTATCCATCTCGCATGAACTACGCCATCTGCTTCCGTCGCCAAACC 360


4734R-1.IR_full       361 GATACTAAGACTCTAACCATTCGCGCCTATGACTTCAACGTGGGAGATGTGGTTTCCGCT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4734R-1.in silico     361 GATACTAAGACTCTAACCATTCGCGCCTATGACTTCAACGTGGGAGATGTGGTTTCCGCT 420


4734R-1.IR_full       421 TCCACCTTGATGACCGATGAGAACTGCTACAGCAGCGATAGTACCAACGATCTGGATGCC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4734R-1.in silico     421 TCCACCTTGATGACCGATGAGAACTGCTACAGCAGCGATAGTACCAACGATCTGGATGCC 480


4734R-1.IR_full       481 GATTTTCTGATGGTGCCACA 500
                          ||||||||||||||||||||
4734R-1.in silico     481 GATTTTCTGATGGTGCCACA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137020.1  CG4734-RA (CG4734), mRNA 
0   NM_133014.2  CG6269-RA (unc-4), mRNA 
0   14  NM_176497.1  CG9297-RB, transcript variant B (CG9297), mRNA 
0   14  NM_176498.1  CG9297-RA, transcript variant A (CG9297), mRNA 
0   NM_142640.2  CG16953-RA (CG16953), mRNA 
0   NM_168610.1  CG13457-RA, transcript variant A (CG13457), mRNA 
0   NM_140494.1  CG13457-RB, transcript variant B (CG13457), mRNA 
0   NM_079222.2  CG8339-RA (sfl), mRNA 
0   NM_136891.2  CG8877-RA (prp8), mRNA 
0   NM_057277.2  CG8694-RA (LvpD), mRNA 
0   NM_138049.2  CG3328-RA (CG3328), mRNA 
0   NM_130674.1  CG12498-RA (CG12498), mRNA 
0   NM_136426.2  CG1707-RA (CG1707), mRNA 
0   NM_001014722.1  CG12212-RB, transcript variant B (peb), mRNA 
0   NM_057326.4  CG12212-RA, transcript variant A (peb), mRNA 
0   NM_132262.2  CG11265-RA, transcript variant A (CG11265), mRNA 
0   NM_206658.1  CG11265-RE, transcript variant E (CG11265), mRNA 
0   NM_206659.1  CG11265-RC, transcript variant C (CG11265), mRNA 
0   NM_206660.1  CG11265-RB, transcript variant B (CG11265), mRNA 
0   NM_166155.1  CG8448-RD, transcript variant D (mrj), mRNA 
0   NM_130662.2  CG2662-RA (CG2662), mRNA 
0   NM_080325.3  CG6450-RC (lva), mRNA 
0   NM_001032265.1  CG4844-RA, transcript variant A (CG4844), mRNA 
0   NM_001032264.1  CG4844-RB, transcript variant B (CG4844), mRNA 
0   NM_001032266.1  CG18431-RA, transcript variant A (CG18431), mRNA 
0   NM_143439.2  CG2010-RB, transcript variant B (CG2010), mRNA 
0   NM_170412.1  CG2010-RA, transcript variant A (CG2010), mRNA 
0   NM_136475.1  CG1946-RA (CG1946), mRNA 
0   NM_135228.1  CG11321-RA, transcript variant A (CG11321), mRNA 
0   NM_164709.1  CG11321-RB, transcript variant B (CG11321), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
+- 
DM
 
VM
 
VB
 
Caspase-3 signal
N
+  
DB
DC
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.