National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4726R-1 
 Symbol CG4726  Full Name CG4726 
 CG No CG4726  Old CG No CG4726 
 Synonyms CG4726 
 Accession No (Link to NCBI) NM_134728.1 
 Inserted Chr. lll 
 Insertional Mutation  2 lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACCACACAGCCATTAAGGCCC 
 Primer Seq. 3'
aatctagaggtaccCAGGAGGATGGAAAGAGCCGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACCACACAGC CATTAAGGCC CACGGAGACG GCGGTGGACA TGGGGGACAC GGCAGCGTCA 
0061 TCCTTTCGAA CGCCTCCCAA GTGTCCCTGG TGGAGGAATG CAACCCGCCG GGTGGTGCCT 
0121 CCAATGTGAC GGCTAAGGTG GAGGACGGTC CCTTCGACTG GAGCGAGCCC CTGCAGGGAA 
0181 CCCTGCTGAG CTGCTACTTC TGGGGCTATT TGGTCTCGCA GATTCCGCTG GCACACGTCG 
0241 CCGAGAACTT CTCCGCCAAG TGGGTGATGC TCTTCTCGGT GGCCATCAAC GTCGTGTGCA 
0301 CGCTGCTAAC GCCCGTCTTT ACTGAATTGC ATTACGGTGG CCTGATTCTG ATGCGAGTGC 
0361 TTGAGGGCGT CGGCGGAGGA GCCTCCTTCC CGGCCATGCA CGTGATGATC GCCTCCTGGG 
0421 CCCCTCCCAC GGAGCGCATG GTCATGTCCA CCATCATCTA CGTGGGCACA TCTGCGGGTA 
0481 CGGCTCTTTC CATCCTCCTG  
 in silico PCR Fragment
0001 ACCACACAGC CATTAAGGCC CACGGAGACG GCGGTGGACA TGGGGGACAC GGCAGCGTCA 
0061 TCCTTTCGAA CGCCTCCCAA GTGTCCCTGG TGGAGGAATG CAACCCGCCG GGTGGTGCCT 
0121 CCAATGTGAC GGCTAAGGTG GAGGACGGTC CCTTCGACTG GAGCGAGCCC CTGCAGGGAA 
0181 CCCTGCTGAG CTGCTACTTC TGGGGCTATT TGGTCTCGCA GATTCCGCTG GCACACGTCG 
0241 CCGAGAACTT CTCCGCCAAG TGGGTGATGC TCTTCTCGGT GGCCATCAAC GTCGTGTGCA 
0301 CGCTGCTAAC GCCCGTCTTT ACTGAATTGC ATTACGGTGG CCTGATTCTG ATGCGAGTGC 
0361 TTGAGGGCGT CGGCGGAGGA GCCTCCTTCC CGGCCATGCA CGTGATGATC GCCTCCTGGG 
0421 CCCCTCCCAC GGAGCGCATG GTCATGTCCA CCATCATCTA CGTGGGCACA TCTGCGGGTA 
0481 CGGCTCTTTC CATCCTCCTG  
 Assemble Data

4726R-1.IR_full       1   ACCACACAGCCATTAAGGCCCACGGAGACGGCGGTGGACATGGGGGACACGGCAGCGTCA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4726R-1.in silico     1   ACCACACAGCCATTAAGGCCCACGGAGACGGCGGTGGACATGGGGGACACGGCAGCGTCA 60


4726R-1.IR_full       61  TCCTTTCGAACGCCTCCCAAGTGTCCCTGGTGGAGGAATGCAACCCGCCGGGTGGTGCCT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4726R-1.in silico     61  TCCTTTCGAACGCCTCCCAAGTGTCCCTGGTGGAGGAATGCAACCCGCCGGGTGGTGCCT 120


4726R-1.IR_full       121 CCAATGTGACGGCTAAGGTGGAGGACGGTCCCTTCGACTGGAGCGAGCCCCTGCAGGGAA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4726R-1.in silico     121 CCAATGTGACGGCTAAGGTGGAGGACGGTCCCTTCGACTGGAGCGAGCCCCTGCAGGGAA 180


4726R-1.IR_full       181 CCCTGCTGAGCTGCTACTTCTGGGGCTATTTGGTCTCGCAGATTCCGCTGGCACACGTCG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4726R-1.in silico     181 CCCTGCTGAGCTGCTACTTCTGGGGCTATTTGGTCTCGCAGATTCCGCTGGCACACGTCG 240


4726R-1.IR_full       241 CCGAGAACTTCTCCGCCAAGTGGGTGATGCTCTTCTCGGTGGCCATCAACGTCGTGTGCA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4726R-1.in silico     241 CCGAGAACTTCTCCGCCAAGTGGGTGATGCTCTTCTCGGTGGCCATCAACGTCGTGTGCA 300


4726R-1.IR_full       301 CGCTGCTAACGCCCGTCTTTACTGAATTGCATTACGGTGGCCTGATTCTGATGCGAGTGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4726R-1.in silico     301 CGCTGCTAACGCCCGTCTTTACTGAATTGCATTACGGTGGCCTGATTCTGATGCGAGTGC 360


4726R-1.IR_full       361 TTGAGGGCGTCGGCGGAGGAGCCTCCTTCCCGGCCATGCACGTGATGATCGCCTCCTGGG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4726R-1.in silico     361 TTGAGGGCGTCGGCGGAGGAGCCTCCTTCCCGGCCATGCACGTGATGATCGCCTCCTGGG 420


4726R-1.IR_full       421 CCCCTCCCACGGAGCGCATGGTCATGTCCACCATCATCTACGTGGGCACATCTGCGGGTA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4726R-1.in silico     421 CCCCTCCCACGGAGCGCATGGTCATGTCCACCATCATCTACGTGGGCACATCTGCGGGTA 480


4726R-1.IR_full       481 CGGCTCTTTCCATCCTCCTG 500
                          ||||||||||||||||||||
4726R-1.in silico     481 CGGCTCTTTCCATCCTCCTG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134728.1  CG4726-RA (CG4726), mRNA 
0   NM_080096.2  CG7869-RA (SuUR), mRNA 
0   NM_078660.2  CG5424-RB, transcript variant B (f), mRNA 
0   NM_001042819.1  CG5424-RF, transcript variant F (f), mRNA 
0   NM_176745.1  CG5424-RD, transcript variant D (f), mRNA 
0   NM_176746.1  CG5424-RC, transcript variant C (f), mRNA 
0   NM_167563.2  CG5424-RA, transcript variant A (f), mRNA 
0   NM_136488.2  CG8791-RA (CG8791), mRNA 
0   NM_141966.1  CG6188-RA (CG6188), mRNA 
0   NM_170053.2  CG17894-RC, transcript variant C (cnc), mRNA 
0   NM_136599.2  CG8193-RA (CG8193), mRNA 
0   NM_139732.2  CG10542-RA (CG10542), mRNA 
0   NM_135029.2  CG3036-RA (CG3036), mRNA 
0   NM_168570.1  CG8783-RB, transcript variant B (CG8783), mRNA 
0   NM_140423.2  CG8783-RA, transcript variant A (CG8783), mRNA 
0   NM_169312.1  CG9458-RA (CG9458), mRNA 
0   NM_170428.1  CG7834-RB, transcript variant B (CG7834), mRNA 
0   NM_143470.1  CG7834-RA, transcript variant A (CG7834), mRNA 
0   NM_166880.1  CG3051-RB, transcript variant B (SNF1A), mRNA 
0   NM_057965.3  CG3051-RA, transcript variant A (SNF1A), mRNA 
0   NM_206604.1  CG3051-RC, transcript variant C (SNF1A), mRNA 
0   NM_080531.2  CG5481-RA (lea), mRNA 
0   12  NM_166310.1  CG15096-RB, transcript variant B (CG15096), mRNA 
0   12  NM_137532.2  CG15096-RA, transcript variant A (CG15096), mRNA 
0   NM_170539.1  CG31004-RA, transcript variant A (CG31004), mRNA 
0   NM_170540.1  CG31004-RB, transcript variant B (CG31004), mRNA 
0   NM_142112.2  CG8279-RA (Pde6), mRNA 
0   NM_057421.2  CG8651-RD, transcript variant D (trx), mRNA 
0   NM_134282.1  CG8651-RA, transcript variant A (trx), mRNA 
0   NM_080188.2  CG31359-RA (Hsp70Bb), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.