National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4715R-4 
 Symbol Iris  Full Name Iris 
 CG No CG4715  Old CG No CG4715 
 Synonyms CG4715, Iris 
 Accession No (Link to NCBI) NM_134726.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
0481 GCCATAATCT CTGcccacca  
 in silico PCR Fragment
 Assemble Data

                          ||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| silico     1   ATGGCGATGCGGGGATTCAACAACAGTCTGGGCACCTTCGTGGAGTACAGCGGTCAGGCA 60

                          || |||||||||||||||||||||| |||||||||||||||||||||||||||||||||| silico     61  TCGCTAGCCTCCAGAGATTGGAAGTTATGTGCCAGCTTCAACTTGGAGTCGCTTTATACG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GCAATACGTGCGTTCAATGGTGTCTACAAGGCTTTGGTCGATGTGTGCGATATCCAAAGG 180

                          | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| silico     181 AATCTTTGTCCAGAAATTCTGGACATTACCAAGTTTGCGGATAGTATTCTTCACGATGGA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CTAATTGACTTGGAGAAAGCGTTGGACTTTAGGGCCGGACGACTTTCTTTGGGAGATGAC 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GACGTGTCCATCGAGCTTGGGATGGGAACATCCTGCATTGACAGCTCCATTAATGTTATA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AATGTGATACTTCAAGAACCCTTTCACGAGGCTTATGAACCTGAAAACCTGATTATGATG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AAGCCGTATCTATACCTTATGGGCAGCAGACTAAAAAGTGCCCAGAATGCCATAACTGAA 480

4715R-4.IR_full       481 GCCATAATCTCTGCCCACCA 500
                          |||||||||||||||||||| silico     481 GCCATAATCTCTGCCCACCA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134726.2  CG4715-RA (Iris), mRNA 
0   NM_057864.3  CG9127-RA, transcript variant A (ade2), mRNA 
0   NM_164675.1  CG9127-RB, transcript variant B (ade2), mRNA 
0   NM_164676.1  CG9127-RC, transcript variant C (ade2), mRNA 
0   NM_167109.1  CG4607-RB, transcript variant B (CG4607), mRNA 
0   NM_132152.1  CG4607-RA, transcript variant A (CG4607), mRNA 
0   NM_167282.2  CG1725-RA, transcript variant A (dlg1), mRNA 
0   NM_078565.3  CG1725-RD, transcript variant D (dlg1), mRNA 
0   NM_206682.2  CG1725-RG, transcript variant G (dlg1), mRNA 
0   NM_206684.2  CG1725-RE, transcript variant E (dlg1), mRNA 
0   NM_206681.2  CG1725-RH, transcript variant H (dlg1), mRNA 
0   NM_206683.2  CG1725-RB, transcript variant B (dlg1), mRNA 
0   NM_079599.3  CG14719-RA (I-t), mRNA 
0   NM_143387.1  CG14523-RA (CG14523), mRNA 
0   NM_142228.1  CG5623-RA (CG5623), mRNA 
0   NM_142385.1  CG14322-RA (CG14322), mRNA 
0   NM_078857.2  CG5876-RA (heix), mRNA 
0   NM_143790.1  CG11538-RA (CG11538), mRNA 
0   NM_080077.2  CG6806-RA (Lsp2), mRNA 
0   NM_143682.4  CG17461-RA (Kif3C), mRNA 
0   NM_176180.1  CG12970-RB, transcript variant B (CG12970), mRNA 
0   NM_137218.1  CG12970-RA, transcript variant A (CG12970), mRNA 
0   NM_142340.2  CG5148-RA (CG5148), mRNA 
0   NM_143085.1  CG11848-RA (CG11848), mRNA 
0   NM_001031934.1  CG14987-RB (Gr64d), mRNA 
0   NM_140697.2  CG7853-RA (CG7853), mRNA 
0   NM_168670.1  CG32158-RB, transcript variant B (CG32158), mRNA 
0   NM_001015214.1  CG40160-PC.3 (CG40160), mRNA 
0   NM_001015212.1  CG40160-PA.3 (CG40160), mRNA 
0   NM_001015213.1  CG40160-PB.3 (CG40160), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.