National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4715R-3 
 Symbol Iris  Full Name Iris 
 CG No CG4715  Old CG No CG4715 
 Synonyms CG4715, Iris 
 Accession No (Link to NCBI) NM_134726.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGCGATGCGGGGATTCAAC 
 Primer Seq. 3'
aatctagaggtaccTGGTGGGCAGAGATTATGGCT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGGCGATGC GGGNATTCAA CAACAGTCTG GGCACCTTCG TGGAGNACAG CGGTCAGGCN 
0061 TCNCTAGCCT CCAGAGATTG GAAGTNATGT GCCAGCTTCA ACTTGGAGTC GCTTTATACG 
0121 GCAATACGTG CGTTCAATGG TGTCTACAAG GCTTTGGTCG ATGTGTGCGA TATCCAAAGG 
0181 AGTCTTTGTC CAGAAATTCT GCACATTACC AAGTTTGCGG ATAGTATTCT TCACGATGGA 
0241 CTAATTGACT TGGAGAAAGC GTTGGACTTT AGGGCCGGAC GACTTTCTTT GGGAGATGAC 
0301 GACGTGTCCA TCGAGCTTGG GATGGGAACA TCCTGCATTG ACAGCTCCAT TAATGTTATA 
0361 AATGTGATAC TTCAAGAACC CTTTCACGAG GCTTATGAAC CTGAAAACCT GATTATGATG 
0421 AAGCCGTATC TATACCTTAT GGGCAGCAGA CTAAAAAGTG CCCAGAATGC CATAACTGAA 
0481 GCCATAATCT CTGcccacca  
 in silico PCR Fragment
0001 ATGGCGATGC GGGGATTCAA CAACAGTCTG GGCACCTTCG TGGAGTACAG CGGTCAGGCA 
0061 TCGCTAGCCT CCAGAGATTG GAAGTTATGT GCCAGCTTCA ACTTGGAGTC GCTTTATACG 
0121 GCAATACGTG CGTTCAATGG TGTCTACAAG GCTTTGGTCG ATGTGTGCGA TATCCAAAGG 
0181 AATCTTTGTC CAGAAATTCT GGACATTACC AAGTTTGCGG ATAGTATTCT TCACGATGGA 
0241 CTAATTGACT TGGAGAAAGC GTTGGACTTT AGGGCCGGAC GACTTTCTTT GGGAGATGAC 
0301 GACGTGTCCA TCGAGCTTGG GATGGGAACA TCCTGCATTG ACAGCTCCAT TAATGTTATA 
0361 AATGTGATAC TTCAAGAACC CTTTCACGAG GCTTATGAAC CTGAAAACCT GATTATGATG 
0421 AAGCCGTATC TATACCTTAT GGGCAGCAGA CTAAAAAGTG CCCAGAATGC CATAACTGAA 
0481 GCCATAATCT CTGCCCACCA  
 Assemble Data

4715R-3.IR_full       1   ATGGCGATGCGGGNATTCAACAACAGTCTGGGCACCTTCGTGGAGNACAGCGGTCAGGCN 60
                          ||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| 
4715R-3.in silico     1   ATGGCGATGCGGGGATTCAACAACAGTCTGGGCACCTTCGTGGAGTACAGCGGTCAGGCA 60


4715R-3.IR_full       61  TCNCTAGCCTCCAGAGATTGGAAGTNATGTGCCAGCTTCAACTTGGAGTCGCTTTATACG 120
                          || |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
4715R-3.in silico     61  TCGCTAGCCTCCAGAGATTGGAAGTTATGTGCCAGCTTCAACTTGGAGTCGCTTTATACG 120


4715R-3.IR_full       121 GCAATACGTGCGTTCAATGGTGTCTACAAGGCTTTGGTCGATGTGTGCGATATCCAAAGG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4715R-3.in silico     121 GCAATACGTGCGTTCAATGGTGTCTACAAGGCTTTGGTCGATGTGTGCGATATCCAAAGG 180


4715R-3.IR_full       181 AGTCTTTGTCCAGAAATTCTGCACATTACCAAGTTTGCGGATAGTATTCTTCACGATGGA 240
                          | ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
4715R-3.in silico     181 AATCTTTGTCCAGAAATTCTGGACATTACCAAGTTTGCGGATAGTATTCTTCACGATGGA 240


4715R-3.IR_full       241 CTAATTGACTTGGAGAAAGCGTTGGACTTTAGGGCCGGACGACTTTCTTTGGGAGATGAC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4715R-3.in silico     241 CTAATTGACTTGGAGAAAGCGTTGGACTTTAGGGCCGGACGACTTTCTTTGGGAGATGAC 300


4715R-3.IR_full       301 GACGTGTCCATCGAGCTTGGGATGGGAACATCCTGCATTGACAGCTCCATTAATGTTATA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4715R-3.in silico     301 GACGTGTCCATCGAGCTTGGGATGGGAACATCCTGCATTGACAGCTCCATTAATGTTATA 360


4715R-3.IR_full       361 AATGTGATACTTCAAGAACCCTTTCACGAGGCTTATGAACCTGAAAACCTGATTATGATG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4715R-3.in silico     361 AATGTGATACTTCAAGAACCCTTTCACGAGGCTTATGAACCTGAAAACCTGATTATGATG 420


4715R-3.IR_full       421 AAGCCGTATCTATACCTTATGGGCAGCAGACTAAAAAGTGCCCAGAATGCCATAACTGAA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4715R-3.in silico     421 AAGCCGTATCTATACCTTATGGGCAGCAGACTAAAAAGTGCCCAGAATGCCATAACTGAA 480


4715R-3.IR_full       481 GCCATAATCTCTGCCCACCA 500
                          ||||||||||||||||||||
4715R-3.in silico     481 GCCATAATCTCTGCCCACCA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134726.2  CG4715-RA (Iris), mRNA 
0   NM_057864.3  CG9127-RA, transcript variant A (ade2), mRNA 
0   NM_164675.1  CG9127-RB, transcript variant B (ade2), mRNA 
0   NM_164676.1  CG9127-RC, transcript variant C (ade2), mRNA 
0   NM_167109.1  CG4607-RB, transcript variant B (CG4607), mRNA 
0   NM_132152.1  CG4607-RA, transcript variant A (CG4607), mRNA 
0   NM_167282.2  CG1725-RA, transcript variant A (dlg1), mRNA 
0   NM_078565.3  CG1725-RD, transcript variant D (dlg1), mRNA 
0   NM_206682.2  CG1725-RG, transcript variant G (dlg1), mRNA 
0   NM_206684.2  CG1725-RE, transcript variant E (dlg1), mRNA 
0   NM_206681.2  CG1725-RH, transcript variant H (dlg1), mRNA 
0   NM_206683.2  CG1725-RB, transcript variant B (dlg1), mRNA 
0   NM_079599.3  CG14719-RA (I-t), mRNA 
0   NM_143387.1  CG14523-RA (CG14523), mRNA 
0   NM_142228.1  CG5623-RA (CG5623), mRNA 
0   NM_142385.1  CG14322-RA (CG14322), mRNA 
0   NM_078857.2  CG5876-RA (heix), mRNA 
0   NM_143790.1  CG11538-RA (CG11538), mRNA 
0   NM_080077.2  CG6806-RA (Lsp2), mRNA 
0   NM_143682.4  CG17461-RA (Kif3C), mRNA 
0   NM_176180.1  CG12970-RB, transcript variant B (CG12970), mRNA 
0   NM_137218.1  CG12970-RA, transcript variant A (CG12970), mRNA 
0   NM_142340.2  CG5148-RA (CG5148), mRNA 
0   NM_143085.1  CG11848-RA (CG11848), mRNA 
0   NM_001031934.1  CG14987-RB (Gr64d), mRNA 
0   NM_140697.2  CG7853-RA (CG7853), mRNA 
0   NM_168670.1  CG32158-RB, transcript variant B (CG32158), mRNA 
0   NM_001015214.1  CG40160-PC.3 (CG40160), mRNA 
0   NM_001015212.1  CG40160-PA.3 (CG40160), mRNA 
0   NM_001015213.1  CG40160-PB.3 (CG40160), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.