National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4710R-1 
 Symbol smi21F  Full Name smell impaired 21F 
 CG No CG4710  Old CG No CG4710 
 Synonyms CG4710, anon-WO0118547.131, smi21F 
 Accession No (Link to NCBI) NM_164405.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTCCACCACTTCCGTTTCCGT 
 Primer Seq. 3'
aatctagaggtaccCTTCCGGGTAGCTGATGCACA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTCCACCACT TCCGTTTCCG TCTCCTCGTC TCACATTGTC ACCGAGTGGG AGGATGGCAT 
0061 CATTTTCGAT GTGGACGATC CCGACTTTTG CAATCTGGCC ACCGACAAGC TGAACTTCAT 
0121 AGTGCCATCA GCAGCCAATA TGTCGATCGC CAGTGTTCAC GGTCCCCAAA TCGCCGACAT 
0181 CTGCAGTCCC CTGTCGCATC ACAATCTCGG TCTGTCTGCC TCGCTGCCAG ATCTGGTGGG 
0241 CAGTCCCCTG GAGATCAGCA TGGACAACGT GCTGACCATT GAGGAGCTGC GCCAGCACAT 
0301 GGGCTCCTGC TTNCACCTGC GGCGTCTCCT GGACGGACGA CCATGTGTCC CTCGACTGCA 
0361 GCGAATGCGG TGGCTACAGC CTGGAGCGTC CCTGTCCCCT GTGCGACGGC CAGTGCGGTG 
0421 TCCAATGGAA ACGTGATTTC GCCATGTCCC ATGCCTGCAG TCAAGCTCGC TGGGTGGGCG 
0481 TGTGCATCAG CTACCCGGAA G 
 in silico PCR Fragment
0001 CTCCACCACT TCCGTTTCCG TCTCCTCGTC TCACATTGTC ACCGAGTGGG AGGATGGCAT 
0061 CATTTTCGAT GTGGACGATC CCGACTTTTG CAATCTGGCC ACCGACAAGC TGAACTTCAT 
0121 AGTGCCATCA GCAGCCAATA TGTCGATCGC CAGTGTTCAC GGTCCCCAAA TCGCCGACAT 
0181 CTGCAGTCCC CTGTCGCATC ACAATCTCGG TCTGTCTGCC TCGCTGCCAG ATCTGGTGGG 
0241 CAGTCCCCTG GAGATCAGCA TGGACAACGT GCTGACCATT GAGGAGCTGC GCCAGCACAT 
0301 GGGCTCCTGC TT-CACCTGC GGCGTCTCCT GGACGGACGA CCATGTGTCC CTCGACTGCA 
0361 GCGAATGCGG TGGCTACAGC CTGGAGCGTC CCTGTCCCCT GTGCGACGGC CAGTGCGGTG 
0421 TCCAATGGAA ACGTGATTTC GCCATGTCCC ATGCCTGCAG TCAAGCTCGC TGGGTGGGCG 
0481 TGTGCATCAG CTACCCGGAA G 
 Assemble Data

4710R-1.IR_full       1   CTCCACCACTTCCGTTTCCGTCTCCTCGTCTCACATTGTCACCGAGTGGGAGGATGGCAT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4710R-1.in silico     1   CTCCACCACTTCCGTTTCCGTCTCCTCGTCTCACATTGTCACCGAGTGGGAGGATGGCAT 60


4710R-1.IR_full       61  CATTTTCGATGTGGACGATCCCGACTTTTGCAATCTGGCCACCGACAAGCTGAACTTCAT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4710R-1.in silico     61  CATTTTCGATGTGGACGATCCCGACTTTTGCAATCTGGCCACCGACAAGCTGAACTTCAT 120


4710R-1.IR_full       121 AGTGCCATCAGCAGCCAATATGTCGATCGCCAGTGTTCACGGTCCCCAAATCGCCGACAT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4710R-1.in silico     121 AGTGCCATCAGCAGCCAATATGTCGATCGCCAGTGTTCACGGTCCCCAAATCGCCGACAT 180


4710R-1.IR_full       181 CTGCAGTCCCCTGTCGCATCACAATCTCGGTCTGTCTGCCTCGCTGCCAGATCTGGTGGG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4710R-1.in silico     181 CTGCAGTCCCCTGTCGCATCACAATCTCGGTCTGTCTGCCTCGCTGCCAGATCTGGTGGG 240


4710R-1.IR_full       241 CAGTCCCCTGGAGATCAGCATGGACAACGTGCTGACCATTGAGGAGCTGCGCCAGCACAT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4710R-1.in silico     241 CAGTCCCCTGGAGATCAGCATGGACAACGTGCTGACCATTGAGGAGCTGCGCCAGCACAT 300


4710R-1.IR_full       301 GGGCTCCTGCTTNCACCTGCGGCGTCTCCTGGACGGACGACCATGTGTCCCTCGACTGCA 360
                          |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
4710R-1.in silico     301 GGGCTCCTGCTT-CACCTGCGGCGTCTCCTGGACGGACGACCATGTGTCCCTCGACTGCA 360


4710R-1.IR_full       361 GCGAATGCGGTGGCTACAGCCTGGAGCGTCCCTGTCCCCTGTGCGACGGCCAGTGCGGTG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4710R-1.in silico     361 GCGAATGCGGTGGCTACAGCCTGGAGCGTCCCTGTCCCCTGTGCGACGGCCAGTGCGGTG 420


4710R-1.IR_full       421 TCCAATGGAAACGTGATTTCGCCATGTCCCATGCCTGCAGTCAAGCTCGCTGGGTGGGCG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4710R-1.in silico     421 TCCAATGGAAACGTGATTTCGCCATGTCCCATGCCTGCAGTCAAGCTCGCTGGGTGGGCG 480


4710R-1.IR_full       481 TGTGCATCAGCTACCCGGAAG 501
                          |||||||||||||||||||||
4710R-1.in silico     481 TGTGCATCAGCTACCCGGAAG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_164405.1  CG4710-RB, transcript variant B (smi21F), mRNA 
74.68   360  NM_134724.2  CG4710-RA, transcript variant A (smi21F), mRNA 
0   NM_136802.1  CG13227-RA (CG13227), mRNA 
0   NM_137567.1  CG9811-RA (Rgk1), mRNA 
0   NM_142916.1  CG10301-RA (CG10301), mRNA 
0   NM_139390.2  CG13931-RA (CG13931), mRNA 
0   NM_137489.2  CG30118-RA (CG30118), mRNA 
0   11  NM_001014720.1  CG3620-RD, transcript variant D (norpA), mRNA 
0   11  NM_167008.1  CG3620-RB, transcript variant B (norpA), mRNA 
0   11  NM_001014721.1  CG3620-RC, transcript variant C (norpA), mRNA 
0   11  NM_080330.2  CG3620-RA, transcript variant A (norpA), mRNA 
0   NM_143497.2  CG7896-RA (CG7896), mRNA 
0   NM_057921.3  CG7111-RA (Rack1), mRNA 
0   NM_167026.2  CG6824-RB, transcript variant B (ovo), mRNA 
0   NM_080338.3  CG6824-RA, transcript variant A (ovo), mRNA 
0   NM_001038742.1  CG6824-RD, transcript variant D (ovo), mRNA 
0   NM_167027.2  CG6824-RC, transcript variant C (ovo), mRNA 
0   NM_166322.1  CG16720-RB, transcript variant B (5-HT1A), mRNA 
0   NM_057454.3  CG16720-RA, transcript variant A (5-HT1A), mRNA 
0   NM_140524.2  CG12301-RA (CG12301), mRNA 
0   NM_139762.1  CG6600-RA (CG6600), mRNA 
0   NM_140200.1  CG6175-RB (CG6175), mRNA 
0   NM_135146.2  CG9147-RB, transcript variant B (CG9147), mRNA 
0   NM_164680.1  CG9147-RA, transcript variant A (CG9147), mRNA 
0   NM_134789.1  CG15356-RA (CG15356), mRNA 
0   NM_141207.3  CG9853-RA (CG9853), mRNA 
0   NM_057923.2  CG6708-RA (Osbp), mRNA 
0   NM_137555.2  CG7097-RB, transcript variant B (CG7097), mRNA 
0   NM_166335.2  CG7097-RA, transcript variant A (CG7097), mRNA 
0   11  NM_138049.2  CG3328-RA (CG3328), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.